Haplogroupe R1b1c10

R1b1c10 est un sous-clade de l'haplogroupe R1b, descendant de l'Haplogroupe P (Y-ADN), utilisé en génétique comme marqueur d'une population. Il est situé sur le chromosome Y. Il est aussi connu sous la dénomination R1b1b2a2g ou S28/U152 ou R1b1b2a1a2d3a.

Historique

Ce marqueur, découvert en 2005[1], a été référencé par l'ISOGG en 2006. La mutation liée à ce marqueur semble dater de 11400 ans (à 1000 ans près)[2] mais les estimations varient selon les auteurs.

Aspect technique

La mutation R-U152

Référence SNP
Forward PCR
Reverse PCR
Taille(bp)
Position(bp)
R-U152
rs1236440: G>A
cttagctatacagcctctttttgg
aacattccacgcttgaggataa
172
127


Selon David K Faux[3]

Répartition géographique et historique

Le marqueur R1b1C10 est probablement celui des Celtes de La Tène[4]. La répartition est centrée sur le nord ouest de la Suisse. Une base de données est disponible[5] et collecte les données des porteurs de cette mutation.

Décodage

Plusieurs sociétés décodent ce marqueur :

  • Family tree DNA
  • 23andme
  • EthnoAncestry
  • deCODEme

Références

  1. JF Wilson, Ethnoancestry,2005
  2. Robert McGregor used the Zhivotovsky et al. (2006)
  3. http://www.davidkfaux.org, R-U152 Resources
  4. « cerbere.ca/S28/ »(Archive.orgWikiwixArchive.isGoogleQue faire ?).
  5. http://www.webalice.it/asquecco/deCODEMe_Y_DNA-Forums.xls

Voir aussi

Read other articles:

Cistercian abbot (d. 1225) Arnaud Amalric (Latin: Arnoldus Amalricus; died 1225) was a Cistercian abbot who played a prominent role in the Albigensian Crusade. It is reported that prior to the massacre of Béziers, Amalric, when asked how to distinguish Cathars from Catholics, responded, Kill them [all], for God knows which are His own. Early life He was abbot of Poblet in Catalonia from 1196 to 1198, then of Grandselve from 1198 to 1202.[1] He then became the seventeenth abbot of Cî...

 

Bilanz Teilnehmende Rundfunkanstalt Erste Teilnahme 1998 Anzahl der Teilnahmen 20 (Stand 2021) Höchste Platzierung 7 (2019) Höchste Punktzahl 305 (2019) Niedrigste Punktzahl 16 (1998) Punkteschnitt (seit erstem Beitrag) 59,26 (Stand 2019) Punkteschnitt pro abstimmendem Land im 12-Punkte-System 1,26 (Stand 2019) Dieser Artikel befasst sich mit der Geschichte Nordmazedoniens als Teilnehmer am Eurovision Song Contest. Die Bezeichnung des Landes lautete aufgrund des Namenstreites mit Griechenla...

 

Untuk pulau di New York, lihat Pulau Starbucks (New York). Starbuck Lokasi Pulau Starbuck di Samudera Pasifik Peta Pulau Starbuck Reruntuhan pemukiman guano abad ke-19 di Pulau Starbuck Starbuck dilihat dari luar angkasa Pulau Starbuck (atau Pulau Volunteer) adalah pulau karang tak berpenghuni di Pasifik Tengah, dan merupakan bagian dari Kepulauan Garis Tengah Kiribati. Nama sebelumnya diantaranya Pulau Barren, Pulau Ratu Karang, Pulau Pahlawan, Pulau Low, dan Pulau Starve. Geografi, flora, d...

Unterfeuer Bremerhaven Bremerhavener Unterfeuer „Minarett“ mit Oberfeuer im Hintergrund Bremerhavener Unterfeuer „Minarett“ mit Oberfeuer im Hintergrund Lage: Bremen, Deutschland Geographische Lage: 53° 32′ 40″ N, 8° 34′ 11,3″ O53.5444548.569807Koordinaten: 53° 32′ 40″ N, 8° 34′ 11,3″ OSeekarte Unterfeuer Bremerhaven (Bremen) Turmhöhe: 22,40 m Bauzeit: 1893 Betriebszeit: seit 1893 p4 Das Unterfeuer Bremer...

 

هذه المقالة يتيمة إذ تصل إليها مقالات أخرى قليلة جدًا. فضلًا، ساعد بإضافة وصلة إليها في مقالات متعلقة بها. (يناير 2020) تمثال (عمود) أسطليانسمعلومات عامةالبداية 543[1] سُمِّي باسم جستينيان الأول الثقافة الإمبراطورية البيزنطية البلد تركيا تقع في التقسيم الإداري إسطنبول الم...

 

صيغة ملف صوت أو امتداد ملف صوت (بالإنجليزية: Audio file format)‏ هي صيغة ملف لتخزين بيانات الصوت الرقمي على نظام الحاسوب.[1][2][3] بيانات الصوت يمكن أن تُخزن غير مضغوطة أو يمكن أن تُخزن مضغوطة للتقليل من حجم الملف الصوتي. أنواع الصيغ من المهم التمييز بين صيغة الملف (File Format)،...

Peta Asia dengan bendera nasional, tidak termasuk wilayah yang bergantung dan negara bagian yang diakui sebagian. Ini adalah galeri bendera internasional dan bendera nasional yang digunakan di Asia. Bendera supranasional dan internasional Daftar lengkap bendera yang mewakili organisasi internasional dan supranasional intra-Asia, yang menghilangkan organisasi antarbenua seperti Perserikatan Bangsa-Bangsa: Bendera Masa penggunaan Penggunaan Deskripsi 1945 – Bendera Liga Arab. Bendera Lig...

 

Gentianopsis Gentianopsis ciliata Systematyka[1][2] Domena eukarionty Królestwo rośliny Podkrólestwo rośliny zielone Nadgromada rośliny telomowe Gromada rośliny naczyniowe Podgromada rośliny nasienne Nadklasa okrytonasienne Klasa Magnoliopsida Nadrząd astropodobne Rząd goryczkowce Rodzina goryczkowate Rodzaj Gentianopsis Nazwa systematyczna Gentianopsis Y. C. MaActa Phytotax. Sin. 1: 7. Mar 1951[3][4] Typ nomenklatoryczny G. barbata (J. A. Froelich) Y. C. Ma[3] Synonimy Anthopogon Ne...

 

Comic book series This article is about the comic book Peter Parker, The Spectacular Spider-Man. For the 1990s series, see Peter Parker: Spider-Man. For the animated television series, see The Spectacular Spider-Man (TV series). The Spectacular Spider-ManCover to The Spectacular Spider-Man magazine #1 (July 1968),painted art by Harry RosenbaumPublication informationPublisherMarvel ComicsScheduleMonthlyFormatStandardGenreSuperheroPublication date List magazine: July 1968 – November 1968 (vol...

هذه المقالة يتيمة إذ تصل إليها مقالات أخرى قليلة جدًا. فضلًا، ساعد بإضافة وصلة إليها في مقالات متعلقة بها. (أبريل 2019) لويس ديك معلومات شخصية الميلاد 20 ديسمبر 1950 (73 سنة)  بيرث  مواطنة المملكة المتحدة  الحياة العملية المدرسة الأم جامعة لوفبرا  المهنة لاعب اتحاد الرغب...

 

Area of central eastern Tunisia This article needs additional citations for verification. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed.Find sources: Sahel, Tunisia – news · newspapers · books · scholar · JSTOR (August 2015) (Learn how and when to remove this template message) Ribat of Monastir Amphitheatre of El Jem The Tunisian Sahel (Arabic: الساحل) or more precisely ...

 

Trofa Estação Ferroviária da Trofaa estação da Trofa em 2012 Identificação: 04630 TRO (Trofa)[1] Denominação: Apeadeiro de Trofa Administração: Infraestruturas de Portugal (norte)[2] Classificação: A (apeadeiro)[1] Tipologia: B [3] Linha(s): Linha do Minho (PK 22+445) Altitude: 40 m (a.n.m) Coordenadas: 41°20′14.568″N × 8°32′51.54″W (=+41.33738;−8.54765) Localização na rede (mais mapas: 41° 20′ 14,568″ N, 8° 32′ 51,54″ O; IGeoE) Co...

German identity document German identity cardSpecimen of the credit-card sized German identity card issued since 2 August 2021TypeCompulsory identity documentIssued by GermanyValid in EU and rest of Europe[citation needed] (except Belarus, Russia, Ukraine and United Kingdom[1]) Egypt French overseas territories Georgia Montserrat (max 14 days) Tunisia (organized tours) TurkeyExpiration10 years (age 24 or over)6 years (age under 24) Specimen o...

 

American retail bank headquartered in Idaho D. L. Evans BankTypePrivateIndustryFinancial servicesFounded1904; 119 years ago (1904) in Albion, Idaho, U.S.FounderDavid Lloyd EvansHeadquartersBurley, Idaho, U.S.Areas servedIdaho, UtahKey peopleJohn V. Evans Jr., President and CEOProductsBankingTotal assets$2.9 billion (2022)[1]Websitewww.dlevans.com D. L. Evans Bank[a] is an American retail bank headquartered in Burley, Idaho. It operates branch office...

 

American college football season 1938 Pittsburgh Panthers footballConferenceIndependentRankingAPNo. 8Record8–2Head coachJock Sutherland (15th season)Offensive schemeSingle-wingHome stadiumPitt Stadium(capacity: 69,400)Seasons← 19371939 → 1938 Eastern college football independents records vte Conf Overall Team W   L   T W   L   T Worcester Tech   –   6 – 0 – 0 No. 18 Villanova   –   8 &#...

Dutch footballer Arjan Swinkels Swinkels in 2020Personal informationDate of birth (1984-10-15) 15 October 1984 (age 39)Place of birth Moergestel, NetherlandsHeight 1.84 m (6 ft 0 in)Position(s) Centre-backTeam informationCurrent team Willem II (head of youth)Youth career1990–1993 Audacia Moergestel1993–2003 Willem IISenior career*Years Team Apps (Gls)2003–2012 Willem II 158 (13)2012–2015 Lierse 62 (1)2015–2016 Roda JC Kerkrade 45 (0)2016–2018 Beerschot Wilrijk ...

 

Circle-Vision 360° film attractionO' Canada!EpcotAreaWorld Showcase, Canada PavilionStatusRemovedOpening dateOctober 1, 1982 (original version)September 1, 2007 (updated version)Closing dateAugust 6, 2007 (original version) August 1, 2019 (updated version)Replaced byCanada: Far and Wide Ride statisticsAttraction typeCircle-Vision 360° movieDesignerWED EnterprisesThemeCanadian SightsCapacity610 riders per hourDuration13:53HostCorey Burton (original version) Martin Short (update version)Filme...

 

This article does not cite any sources. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed.Find sources: Pressure carburetor – news · newspapers · books · scholar · JSTOR (October 2008) (Learn how and when to remove this template message) A pressure carburetor is a type of fuel metering system manufactured by the Bendix Corporation for piston aircraft engines, starting in the 1940s...

1997 single by Duncan SheikShe Runs AwaySingle by Duncan Sheikfrom the album Duncan Sheik B-sideFake Plastic TreesView from the Other SideReleasedJuly 31, 1997[1]Length3:38LabelAtlanticSongwriter(s)Duncan SheikProducer(s)Rupert HineDuncan Sheik singles chronology Barely Breathing (1996) She Runs Away (1997) Reasons for Living (1997) She Runs Away is a 1997 song on the debut album of American singer-songwriter Duncan Sheik. It peaked at number 24 on the Billboard Adult Top 40. Track li...

 

TV series or program Ferocious PlanetDVD coverWritten byDouglas G. DavisDirected byBilly O'BrienProductionProducerMary CalleryEditorGrainne GaviganRunning time88 minutesOriginal releaseRelease April 9, 2011 (2011-04-09) Ferocious Planet (released on DVD in some places as The Other Side or Alien Gateway) is a 2011 American television film co-produced by Syfy and MNG films. It was filmed on location in Ireland. It is the 23rd film of the Maneater Series.[1][2] Plo...

 

Strategi Solo vs Squad di Free Fire: Cara Menang Mudah!