Redirect to:
5P or 5-P may refer to: 5p, an arm of Chromosome 5 Five pence (British coin) Five pence (Irish coin) GSAT-5P, an Indian communications satellite Team 5P...
Click to read more »a partial deletion of the short arm of chromosome number 5, also called "5p monosomy" or "partial monosomy". Approximately 90% of cases result from a...
Click to read more »Team 5P (Korean: 오인용) is an animation production team established in 2002. The first members were Hongsuk Kim (Kee-mong), Sangsik Min (Sickman), Donghyuk...
Click to read more »MiG-17PF interceptor, equipped with the Izumrud-5 (RP-5) radar, as the Lim-5P. By 1960, 129 were built. In the late 1950s work commenced in Poland on developing...
Click to read more »The 5P-42 Filin (eagle owl) is a Russian electro-optic countermeasure system developed by Roselectronics for the Russian Armed Forces. The system is designed...
Click to read more »The British decimal five pence coin (5p) is a denomination of sterling coinage worth 5⁄100 of a pound, or five pence. Its obverse has featured the profile...
Click to read more »by Pratt & Whitney J48 engine, 616 built. Re-designated F-9D in 1962. F9F-5P Unarmed photo-reconnaissance version, with longer nose; redesignated RF-9D...
Click to read more »Five pence may refer to: Five pence (British coin), a decimal subdivision of the pound sterling Five pence (Irish coin), a decimal subdivision of the now...
Click to read more »GSAT-5P, or GSAT-5 Prime, was an Indian communications satellite which was lost in a launch failure in December 2010. Part of the Indian National Satellite...
Click to read more »The Lorraine 5P, also called the Lorraine 100CV, Lorraine 110CV and Lorraine 120CV, was a family of five-cylinder air-cooled radial engines designed and...
Click to read more »were also fitted with camera equipment for reconnaissance duties as the F6F-5P. While all F6F-5s were capable of carrying an armament mix of one 20-mm (...
Click to read more »Czech singer-songwriter and guitarist, and the frontman of the pop-rock band 5P. In 1969, he was a founding member of C&K Vocal, and since he left the band...
Click to read more »production between 1863 and 1879. In 1899, billon 5p and 10p were introduced, followed by nickel 5p, 10p, 20p and 40p in 1910. Gold coins continued to...
Click to read more »Progress M-45 (Russian: Прогресс М-45), identified by NASA as Progress 5P, was a Progress spacecraft used to resupply the International Space Station....
Click to read more »miR-324-5p is a microRNA that functions in cell growth, apoptosis, cancer, epilepsy, neuronal differentiation, psychiatric conditions, cardiac disease...
Click to read more »respectively, whereas the WAG-5B are units converted from the WAM-4, and the WAG-5P(x) is a subclass specialised for passenger duties. The WAG-5(x)D and WAG-5(x)E...
Click to read more »Sentinel-5 Precursor (Sentinel-5P) is an Earth observation satellite developed by ESA as part of the Copernicus Programme to close the gap in continuity...
Click to read more »hybridization (FISH). Examples of chromosomal deletion syndromes include 5p-Deletion (cri du chat syndrome), 4p-Deletion (Wolf–Hirschhorn syndrome), Prader–Willi...
Click to read more »Le Mans winner Rinaldo Capello and is part of Oliver Victor Kristensen's 5P Agency. Ahead of 2020, it was announced that Olivieri would step up to WSK-organized...
Click to read more »denoted by the symbol p. New coinage was issued alongside the old coins. The 5p and 10p coins were introduced in April 1968 and were the same size, composition...
Click to read more »control the vehicles and regulate their flight paths. The X-24 (Model SV-5P) was built by Martin Marietta and flown from Edwards. The X-24A was the fourth...
Click to read more »Horizon Robotics, Inc. (Chinese: 地平线; pinyin: Dìpíngxiàn) is a Chinese technology company headquartered in Beijing. The company develops artificial intelligence...
Click to read more »10/– note was replaced by a 50p coin due to spiralling inflation. The new 5p coin correlated with the shilling coin, and the new 10p coin correlated with...
Click to read more »[Radar 5P-27, Radar 5P-27M]. Pravdinsky Radio Plant (in Russian). Archived from the original on 30 June 2015. Retrieved 14 December 2014. "Poliment 5P-20K"...
Click to read more »may be on either side. The specifications and dates of introduction of the 5p, 10p, and 50p coins refer to the current versions. These coins were originally...
Click to read more »piastre coins were introduced, followed in 1926 by aluminium bronze 2p and 5p. In 1929, holed, nickel-brass 1p and silver 10p, 25p and 50p were introduced...
Click to read more »of filling according to: 1s ≪ 2s < 2p ≪ 3s < 3p ≪ 4s < 3d < 4p ≪ 5s < 4d < 5p ≪ 6s < 4f < 5d < 6p ≪ 7s < 5f < 6d < 7p ≪ ... Here the sign ≪ means "much...
Click to read more »include the word "syriennes" and were in denominations of 1⁄2p, 1p, 2p, 2+1⁄2p, 5p, 10p, 25p and 50p. During World War II, rather crudely made 1⁄2p, 1p and 2+1⁄2p...
Click to read more »versions of the 5p, 10p and 50p, corresponding to the current UK issues, were issued in 1998, replacing the larger versions (which for the 5p was eight years...
Click to read more »regulate the expression levels of other genes by several mechanisms. The miR-885-5p form of this microRNA acts as a tumour suppressor in neuroblastoma, through...
Click to read more »Single-pilot resource management (SRM) is defined as the art and science of managing all the resources (both on-board the aircraft and from outside sources)...
Click to read more »Government (12p in 2005) 4p Retailers (5p in 2005) 5p Camelot (5p in 2005) 4.5p Camelot for operating costs 0.5p Camelot for profit[citation needed] According...
Click to read more »sSMCs in tetrasomy 9p requires further study. Isochromosome i (5p) (also termed tetrasomy 5p) is a congenital disorder associated with a wide range of birth...
Click to read more »43 3 423 2 Max Verstappen 2 43 Race: 4; Sprint: 3 1P 6 2P 4P 1F 4 10 2 Ret 5P 41 9 2 1P 1PF 2 11 P 3 34 Race: 3; Sprint: 4 1F 14 1P 421 3 Oscar Piastri...
Click to read more »ScanJet 5p (sold as the ScanJet 5pse at retailers) in January 1997. It was sold alongside the ScanJet 4c as a budget offering. To that end, the ScanJet 5p was...
Click to read more »IA-63 Argentina: A-4 and IA-63, previously IA-58, Finger, Dagger, Mirage 5P, Super Étendard Modernisé, and Mirage III Brazil: AMX, previously Mirage 2000C/B...
Click to read more »'Carro do Ano' Award in 2000, in Portugal The third generation Toledo (Typ 5P) was introduced in 2004, and as a production car made its début at the 2004...
Click to read more »Oil Prices Jump After Trump's Iran Speech Fails To Calm Jitters. Aired 4-5p ET". CNN. Retrieved 11 April 2026. Scannell, Kara. "Ghislaine Maxwell will...
Click to read more »Idaho. 124692 – based at Collings Foundation in Stow, Massachusetts. F4U-5P 122184 – based at Stonehenge Air Museum in Lincoln County, Montana. F4U-7...
Click to read more »3 July 2025. "Copernicus: Sentinel-5P". www.eoportal.org. Retrieved 28 December 2022. "ESA Sentinels-4, -5 and -5P". Retrieved 23 February 2015. "Copernicus:...
Click to read more »Retrieved 2021-09-27. "The 100mm multipurpose shipborne artillery system A-190E-5P-10E | Catalog Rosoboronexport". roe.ru. Retrieved 2021-09-27. "AK-190". Retrieved...
Click to read more »series Y3 (Y360) 3 II 2017 2018 Y5 (Y560) 5c 5 II 2017 2018 Prime lite 2019 5p Y6 6 Pro 6 II Compact 2017 Pro 2018 Prime 2019 Prime Pro 6s 6p Y7 7 Prime...
Click to read more »other mobile phone operators, costing 12.5p/minute for calls (with free calls between TPO users), 7.5p/text and 12.5p/MB for data. It was noted that the company...
Click to read more »Redding Ducati 4 19 9 2F 1P 3 11 7 8 7 15 8 1P 2 3 3 1 15 1F 21 11 1 1 1F 5P 329.5 5 Tommy Bridewell Honda 6 10 C Ret 8 7 3 3 4 5 3 13 6 Ret WD 4 11 10...
Click to read more »target acquisition 3Ts-25 Garpun-B and fire-control radars for artillery 5P-10 Puma, for Kalibr and Oniks missiles 3R14N-11356 and for Buk missiles MR-90...
Click to read more »4dr Sedan 5P, 4dr Touring 5P, 4dr Tourster 4P 1924 6-43 114in 6 50; L6 195.5ci 1b 2dr Coupe 4P, 2dr Sedan 5P, 4dr Sedan 5P, 4dr Touring 5P, 4dr Tourster...
Click to read more »TT Mk2 (8J) Audi Q3 Mk1 (8U) SEAT León Mk2 (1P) SEAT Toledo Mk3 (5P) SEAT Altea (5P) Škoda Octavia Mk2 (1Z) Škoda Yeti (5L) Volkswagen Touran (1T) Volkswagen...
Click to read more »systems 5P-26M Pozitiv-M phased array radar system (Pozitiv-ME1.2 for export) MR-231 navigation radar 5P-10-03 Laska fire control system (5P-10-03E for...
Click to read more »20 9 3 12 21 15 48 11 Tuukka Taponen 12 13 Ret Ret 4 14 6 7 17 12 7 7 6F 5P 46 12 Taito Kato 5 3 16 11 15 9 7 6 18 25 5 6F 14 13 45 13 Jin Nakamura 13...
Click to read more »clubs — 0p, 0r Northern League One – 10 clubs — 1.5p, 1r Football NSW League One – 16 clubs — 1.5p, 1.5r Football Queensland Premier League 1 – 12 clubs...
Click to read more »instance, a purple of medium lightness and fairly saturated would be 5P 5/10 with 5P meaning the color in the middle of the purple hue band, 5/ meaning...
Click to read more »a new naming convention for its LaserJet line. While the LaserJet 5L and 5P were replaced with the LaserJet 6L and 6P, there was never a LaserJet 6; the...
Click to read more »Quarter-finals River Plate 1–2 (A), 1–0 (6–5p) (H) Semi-finals Nacional 2–1 (H), 3–0 (A) Finals São Paulo 2–2 (H), 2–2 (3–5p) (A) Copa Libertadores Group stage...
Click to read more »4 Philippines women's Women's tournament Myanmar L 1–2 Vietnam W 1–0 Malaysia W 6–0 2 Q Thailand W 4–2P 1–1 (a.e.t.) Vietnam W 6–5P 0–0 (a.e.t.)...
Click to read more »Complement 52 Sensors & processing systems 5P-26M1 Pozitiv-M1 phased array radar system MP-231-2 navigation radar 5P-10-03 Laska fire control system МР-123-02...
Click to read more »Ret 2 2 3 7 58.5 8 Oliver Söderström Comtoyou Racing 3P 8 8 9 4 14† Ret 5 7 5P 3 57.5 9 Jamie Day Walkenhorst Motorsport 3 4 2 2 3 7 53.5 10 Alex Malykhin...
Click to read more »Turner Motorsport 5 7 5 7P 7 5P 3 4PF 11 6 5 8 10P 260 2 Matt Bell Blake McDonald DXDT Racing 17 14 4F 5 5 7F 6 5 6 5P 6 4 22 195 3 Jeff Burton Philip...
Click to read more »thread form had the crests rounded at 1/6p and the roots rounded at 1/5p so the thread angle was close to 47.5° but not exactly. This was simplified...
Click to read more »florins (2 shillings) remained legal tender after decimalisation (as 2½p, 5p and 10p respectively) until 1980, 1990 and 1993 respectively, but are now...
Click to read more »Tour-5p.;Rbt.-3p.; Limo(1909); Toy Tonneau-5p. Model J-10, J-30(1910–1911) 4-Cylinder 30 110" N/A Rds.-2 passenger; Toy Tonneau(1910)-5p.; Touring-5p. Model...
Click to read more »"It's a Mistake" is a song by the Australian band Men at Work. The song was written by lead singer and guitarist Colin Hay and the recording was produced...
Click to read more »phosphide is a solid solution of indium phosphide and gallium phosphide. Ga0.5In0.5P is a solid solution of special importance, which is almost lattice matched...
Click to read more »the circulating British coinage from mid-2008. The designs for the 1p, 2p, 5p, 10p, 20p and 50p coins depict sections of the Royal Shield that form the...
Click to read more »boats. "Артиллерийский комплекс "А-192–5П–10Э"" [Artillery complex "A-192-5P-10E"]. Concern Morinformsystem-Agat (in Russian). Archived from the original...
Click to read more »as the greatest whales". Lethaia. 56 (2): 1–11. Bibcode:2023Letha..56..2.5P. doi:10.18261/let.56.2.5. ISSN 0024-1164. S2CID 259782734. Dal Sasso, Cristiano;...
Click to read more »reverted to 5P/5F at some point after their return to the London Midland Region in 1955; only No. 10000 was marked 5P/5F; No. 10001 was marked 5P/5FA. Their...
Click to read more »4K@30/60fps, 1080p@30/60/120/240fps Front camera GalaxyCore GC32E1; 32 MP (5P lens), f/2.2, 22mm (wide), FoV 88.9°, 1/3.1", 0.7 µm, FF Camera features:...
Click to read more »Programmes included: Patagonia: Earth's Secret Paradise, ITV News on new 5p plastic bag charge, Strictly Come Dancing, Doctor Foster, Eternal Glory, Pauline's...
Click to read more »Paisa) till 1 June 1964 when the term 'Naya' was dropped. The coins of 1p, 2p, 5p, 10p, 25p, and 50p had a legend in Devanagari script explaining the value...
Click to read more »and a twenty-word message cost one shilling (5p) up to 100 miles (160 km), one shilling and sixpence (7.5p) up to 200 miles (320 km), and two shillings...
Click to read more »Cameron) by pinfall Women's Owen Hart Cup Tournament first round match 8:35 5P Lucha Brothers (Penta El Zero Miedo and Rey Fénix) and Místico (with Alex...
Click to read more »Eider 12H Pétrel 12Rcr Radium 12R Sterna 18G Orion Radial piston engines 5P 7M Mizar 9N Algol 14A 18F Sirius See also: Lorraine-Dietrich aero-engines...
Click to read more »Points 1 Jarno Opmeer 4F 1 11 2F 9 6 7 3 1 1 5 7 154 2 Ismael Fahssi 1P 4 3P 5P 12 17 2 6F 7 4 3 5 135 3 Bari Broumand 17 Ret 1 13 7 15 1P 2 2 12 1P 3 134...
Click to read more »Park Jungsang 9p Li Zhe 6p Women's Individual Song Ronghui 1p Lee Minjin 5p Pak Chi-eun 9p Open Jo Tae-Won 7d Ham Youngwoo 7d Lee Yong Hee 6d Men's Team...
Click to read more »Caza (Dagger, then also Mirage III and Mirage 5P), based at Tandil Grupo X de Caza (Mirage III, then Mirage 5P), based at Río Gallegos Total number of aircraft...
Click to read more »MiG-17F, 1 x Lim-5P (MiG-17PF), 6 x MiG-21F-13. 1980: 1 x MiG-17F, 1 x Lim-5P (MiG-17PF), 6 x MiG-21F-13. 1981: 2 x MiG-17F, 1 x Lim-5P, 6 x MiG-21F-13...
Click to read more »Eider 12H Pétrel 12Rcr Radium 12R Sterna 18G Orion Radial piston engines 5P 7M Mizar 9N Algol 14A 18F Sirius See also: Lorraine-Dietrich aero-engines...
Click to read more »and switched to a classic hits format, branded as "Classic Hits 99.3" at 5p.m. on September 2. The Bob and Tom Show Ken Paradise Jeff Michaels In the...
Click to read more »also known as SDSS J1416+13B) is a brown dwarf of spectral type T7.5, or T7.5p. It has unusually extremely blue near-infrared color H−K, very red optical-to-near-infrared...
Click to read more »5 Alessandro Zaccone Tech3 E-Racing RetF 12 Ret 4 5 3 2P F 6P DSQP 1P 2P 5P 6 5 2 8 179 6 Jordi Torres Openbank Aspar Team Ret 5 4 Ret 7 4 Ret 12 3 5...
Click to read more »radar: 3Ts-25 Garpun-B, MR-212/201-1, Nucleus-2 6000A Fire control radar: JSC 5P-10 Puma FCS, 3R14N-11356 FCS, MR-90 Orekh SAM FCS Electronic warfare & decoys...
Click to read more »Panorama Airways IATA ICAO Call sign 5P UZP — Founded 2021 Ceased operations 2024 Hubs Tashkent Fleet size 2 Destinations 8 Headquarters Tashkent, Uzbekistan...
Click to read more »{\displaystyle V={\tfrac {1}{3}}\left(5P+6H\right)} vertices, and E = 1 2 ( 5 P + 6 H ) {\displaystyle E={\tfrac {1}{2}}\left(5P+6H\right)} edges. The Euler...
Click to read more »50 50 32 Pixel Size 1.12 μm 0.8 μm 0.64 μm 0.8 μm Lens Quantity 7P 1G3P 6P 5P ALC lens coating Yes No Optical Image Stabilization Electronic Image Stabilization...
Click to read more »2 2 6 Ret 5 1F 9 147 3 Rafael Câmara 11 2 10 3F 7 14 8 RetP 6 1P 9F 4 10 5P 6 1P F 4 3 145 4 Alex Dunne 3 Ret 3 Ret 13 2 9 2 8 2 4 6 9 4 5 4 19 11 108...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. S2CID 16578516. Media related to Pome at Wikimedia...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »a rule, period 5 elements fill their 5s shells first, then their 4d, and 5p shells, in that order; however, there are exceptions, such as rhodium. This...
Click to read more »Unai Orradre Kalex 2F 2F 3PF 2P 3 2F 2 132 3 Eric Fernández Boscoscuro 11P 5P 2 1F 4P 5 4 98 4 Francesco Mongiardo Kalex 3 8 4 4 2F 6 8 88 5 Alessandro...
Click to read more »radar: 3Ts-25 Garpun-B, MR-212/201-1, Nucleus-2 6000A Fire control radar: JSC 5P-10 Puma FCS, 3R14N-11356 FCS, MR-90 Orekh SAM FCS Electronic warfare & decoys...
Click to read more »series Y3 (Y360) 3 II 2017 2018 Y5 (Y560) 5c 5 II 2017 2018 Prime lite 2019 5p Y6 6 Pro 6 II Compact 2017 Pro 2018 Prime 2019 Prime Pro 6s 6p Y7 7 Prime...
Click to read more »Ireland Assembly £5,483 + 4.6p per elector £5,483 + 6.2p per elector Scottish Parliament and Senedd £5,761 + 4.8p per elector £5,761 + 6.5p per elector...
Click to read more »<36/4> 4144° <40/4> → <20/2> 4147° <44/4> 4150° <48/4> → <12> 5θ 4-isogonal <5p/5> 560° <15/5> 590° <20/5> 5108° open 5120° <30/5> 5128.57° <35/5> 5135° <40/5>...
Click to read more »amount but the seller will receive only that number of pounds. The difference (5p in each guinea) is traditionally the auctioneer's commission (which thus,...
Click to read more »Complement 210 Sensors & processing systems Air search radar(S): Furke-4 5P-27 main radar for Detection, tracking and targeting of air and surface targets...
Click to read more »Sentinel-3A (Feb 2016) Sentinel-1B (Apr 2016) Sentinel-2B (Mar 2017) Sentinel-5P (Oct 2017) Sentinel-3B (Apr 2018) Sentinel-6A (Nov 2020) Sentinel-2C (Sep...
Click to read more »Calderasib Clinical data Other names MK-1084 Identifiers IUPAC name (5P,17aM)-20-chloro-2-[(2S,5R)-2,5-dimethyl-4-(prop-2-enoyl)piperazin-1-yl]-14...
Click to read more »FR SR FR SR FR SR FR SR FR SR FR SR FR SR FR SR FR 1 Gabriel Bortoleto 6 5P 10 Ret Ret Ret 6 2P 2 8 5 10 4 1 4 6 16 4 10 2F 8 1 5 4F 5 3 2 2 214.5 2 Isack...
Click to read more »An-2, La-9, Yak-11, and Yak-18 aircraft and the MiG-15bis/UTI, MiG-17/Lim-5P, An-14A, Il-14P, MiG-9, MiG-19, Il-28, Mi-4, and Ka-26 in 1956 which were...
Click to read more »into circulating British coinage from mid-2008. The designs for the 1p, 2p, 5p, 10p, 20p and 50p coins depict sections of the Royal Shield that form much...
Click to read more »Air Passenger Duty for business class tickets. Duty on fuel frozen, with 5p cut in petrol and diesel duty extended for a further year. Extension of the...
Click to read more »and 3d; the fourth shell has 4s, 4p, 4d and 4f; the fifth shell has 5s, 5p, 5d, and 5f and can theoretically hold more in the 5g subshell that is not...
Click to read more »Ozalp (AUS) 6 Damon Sansum (GBR) 8 Damon Sansum (GBR) 7 Damon Sansum (GBR) 5P Sagynysh Kalimbetov (KAZ) DQ Sagynysh Kalimbetov (KAZ) 3 Carlos Rivas (VEN)...
Click to read more »Type Engine HP Wheelbase Transmission Touring-5p. Two-cylinder 20 94.5" 2-speed sliding-gear Touring-5p. Four-cylinder 24 104" 2-speed sliding-gear...
Click to read more »officially ceased trading on the Stock Exchange as of 8 am on 18 July 2007 at 5p a share. Allardyce departed the club on in January 2008 by mutual consent...
Click to read more »nuclear charge (nuclear attractive force on electrons) by 4f electrons; the 5p and 5s electrons (which are the outermost electrons in the 3+ ions) are drawn...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »equipped with a mixed bag of eight F6F-5N Hellcat night fighters, two F6F-5P photo reconnaissance Hellcats and eight F4U-1D Corsairs. This mix of aircraft...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. (Referring to the subfamily by the name "Spiraeoideae")...
Click to read more »media personality or "tarento" (タレント). Bejean April 1999 (5p., nude) Weekly Playboy June 6, 2000 (5p., nude) August 22–29, 2000 (1p., nude) December 26–31...
Click to read more »Yamaha 11 1F 3F 7 1 3F 2P DNS DSQ RetF 2F 136 2 Paolo Casoli Ducati 2 Ret 8 1 5P 2P Ret 1 4 Ret 5 133 3 Stéphane Chambon Suzuki 3 3 1 9 3 Ret 8 2P 1 Ret 133...
Click to read more »2F 9 7 104.5 3 Ben Green Konsta Lappalainen Emil Frey Racing 2P 5 4 7 3 1F 5P 13 4 12 62.5 4 Giacomo Altoè Thierry Vermeulen Emil Frey Racing 11 2 3 4 8...
Click to read more »Especial 2000 (FL-90) — 1978–1979 13: SEAT 124 5p (FJ) / SEAT 124 D 5p (FJ-02) / SEAT 124 D Versión ´75 5p (FN) — 1969–1976 SEAT's first serious attempt...
Click to read more »R2 R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 1 Kasma Daniel Yamaha Ret 1F 2PF 13P 2P 5P 7 3 2PF 2P 6 4 167 2 Anupab Sarmoon Yamaha 5 2 3 3 1 4 12 Ret 3 6 2F 3 167...
Click to read more »Complement 300 Sensors & processing systems "Fregat-M" Air / Surface Search Radar 5P-30N2 "Fregat-N2" Air / Surface Search Radar MG-757 "Anapa-M" anti-saboteur...
Click to read more »A-190E 100 mm gun first used in the Talwar-class frigates is controlled by a 5P-10E system that can track four targets simultaneously. Protection from air...
Click to read more »withdrawn from circulation in December 1984. One penny 1p Two pence 2p Five pence 5p A direct replacement for the shilling. The coin was reduced in size in 1990...
Click to read more »Eider 12H Pétrel 12Rcr Radium 12R Sterna 18G Orion Radial piston engines 5P 7M Mizar 9N Algol 14A 18F Sirius See also: Lorraine-Dietrich aero-engines...
Click to read more »1P 1P 2 2 1P 4P 12 6 13 1 C 2 177 2 Takuma Matsuyama 2 2 3 5 3 Ret 1 1 1P 5P C RetP 169 3 Afridza Munandar Ret 5 1 3 2 1 RetP 3P 2 7 C 142 4 Adenanta Putra...
Click to read more »Instruments Vocals drums guitar Years active 1980–present Member of Jasná Páka Formerly of Žentour Pusa Chinaski Blue Effect 5P Lucie Website davidkoller.cz...
Click to read more »designation functions for cruise missiles) 5P-26/MR-352 Pozitiv-ME1/-ME1.2 3D active shipborne radars 5P-10E-03E Laska fire control radar for naval gun...
Click to read more »Hocq Tower (coastal defence) 2p L'Hermitage, site where St. Helier lived 5p Seymour Tower (offshore defence) 10p La Pouquelaye de Faldouet (dolmen) 20p...
Click to read more »the 2p and 10p coins weighed twice the 1p and 5p respectively; this correlation was continued when the 5p (1990) and 10p (1992) coins were reduced in size...
Click to read more »Forms pyrophosphates. Triphosphoric acid (or tripolyphosphoric acid), H 5P 3O 10 (or (HO) 2P–O–P(OH)–O–P(OH) 2), with five acidic hydrogens. Forms triphosphates...
Click to read more »A-190E 100mm gun first used in the Talwar-class frigates is controlled by a 5P-10E system that can track four targets simultaneously. Protection from air...
Click to read more »Moly Dynavolt Intact GP 1P F 2P 22F 3P 1P F 1P RetF 9 1F 3 4 3 RetP 3 4 6F 5P DSQ 7 25 6 22 257 3 Barry Baltus Kalex Fantic Racing 6 12 7 6F 2 2F Ret 3...
Click to read more »battalion active since 1957 Power Five conferences, in American college football 5P (disambiguation) This disambiguation page lists articles associated with the...
Click to read more »5p_{n}+4p_{n+1}-p_{n+2})u^{2}+(-p_{n-1}+p_{n+1})u+2p_{n}{\big )}\\&={\tfrac {1}{2}}{\Big (}{\big (}(-p_{n-1}+3p_{n}-3p_{n+1}+p_{n+2})u+(2p_{n-1}-5p...
Click to read more »Sentinel-3A (Feb 2016) Sentinel-1B (Apr 2016) Sentinel-2B (Mar 2017) Sentinel-5P (Oct 2017) Sentinel-3B (Apr 2018) Sentinel-6A (Nov 2020) Sentinel-2C (Sep...
Click to read more »2001-04-20, GSAT-1 Mission, GSLV debut flight Last flight 2010-12-25, GSAT-5P launch, GSLV Mk I final flight Designer KB KhIMMASH Application Upper stage...
Click to read more »the industrial engineering sector. ASSOCIATED BRITISH ENGINEERING PLC ORD 2.5P. London Stock Exchange. Retrieved 12 June 2015. http://www.abeplc.co.uk v...
Click to read more »CNN: Boston Pops Fireworks Spectacular; world War Two Hero Honored. Aired 4-5p ET". CNN Transcripts. 4 July 2026. Retrieved 8 July 2026 – via CNN. Severson...
Click to read more »"River" class, originally built for Highland Railway. 956 1921 St. Rollox 4 5P 14800–14803 0-4-4T 159 1915–22 St. Rollox 10 2P 15227–15236 non-superheated...
Click to read more »October 7. Then season 1 started broadcasting on Tuesday, October 11 on GetTV 5p-6:30p PT/8p-9:30p ET with repeats the following Friday night/Saturday morning...
Click to read more »Carolina Fernández (VEN) 4 1 Bianca Cook (GBR) 4 2 Solène Avoulète (FRA) 5P 4 Solène Avoulète (FRA) 2 1 Kalina Boyadzhieva (BUL) 7 3 Solène Avoulète (FRA)...
Click to read more »Ljubljana 1972 Velež Mostar 3-0 Red Star Belgrade Vojvodina Novi Sad 2-2 (6-5p) Željezničar Sarajevo 1973 Velež Mostar 2-1 Željezničar Sarajevo Hajduk Split...
Click to read more »Sentinel-3A (Feb 2016) Sentinel-1B (Apr 2016) Sentinel-2B (Mar 2017) Sentinel-5P (Oct 2017) Sentinel-3B (Apr 2018) Sentinel-6A (Nov 2020) Sentinel-2C (Sep...
Click to read more »launched a limited edition Belgian Chocolate Bar with Greggs in August 2015; 5p proceeds from each sale being donated towards the trust. In November 2016...
Click to read more »5 12 8 107 2 Gabriele Piana Thomas Rackl Borusan Otomotiv Motorsport Ret 5P 9 12 1 1 Ret 4 83 3 McKenzy Cresswell Charlie Hart Elite Motorsport with Entire...
Click to read more »Symbol penny p Denominations Banknotes £1, £5, £10, £20, £50 Coins 1p, 2p, 5p, 10p, 20p, 50p, £2 Demographics User(s) Guernsey Issuance Treasury Treasury...
Click to read more »Husqvarna 10 Ret 10 4 RetF 17 8 28 6 7F 5 3 79 10 Brian Uriarte KTM 2F 1F 5P 4 8 78 11 Casey O'Gorman Honda 4 5 RetF Ret 15 3 6 7 Ret 3 Ret Ret 76 12 Facundo...
Click to read more »£1, and £5; post-decimalisation, it went 5p, 10p, 20p, 50p, £1, and £5; towards the end of the run, the 5p level was removed (contestants correspondingly...
Click to read more »match — 4P Suzu Suzuki won by last eliminating Mei Seira Battle royal 16:00 5P Hanan defeated Mariah May 5 Star Grand Prix tournament match 8:47 6 Momo Watanabe...
Click to read more »leading to a collapse in the share price to a low of 73.5p, compared to its 12-month high of 557.5p.[unreliable source?] The Independent's media columnist...
Click to read more »Trailers and as Trailor (Trailmobile Lorraine) manufactured trucks. Lorraine 5P – 5 cyl radial Lorraine 6A – (AM) 110 hp Lorraine 7M Mizar – 7 cyl radial...
Click to read more »Britain, and were the only 4-4-0 type to be given the power classification of 5P by British Railways. They were well liked by crews. They also had a higher...
Click to read more »of launching a new crewed spacecraft weighing up to 18 tonnes: the Angara 5P. This version would have 4 URM-1s as boosters surrounding a sustainer core...
Click to read more »supplement brand called Dynamik Muscle in 2015, and a training program called The 5P in May 2016. The latter is named after the acronym for his motto, "Proper...
Click to read more »MR-123-02/MR-123-03 and Vympel-AME MR-123-02/176) 1 tonne (2,200 lb) (Laska 5P-10E) Barrel length 1,629 mm (64 in) (total) 1,460 mm (57 in) (rifled) Width...
Click to read more »Force to Argentina during the 1982 Falklands War, together with ten Mirage 5P fighters. The AS-30L was deployed by Iraqi Mirage F1 aircraft during the Iran–Iraq...
Click to read more »000 397 27 May 1993 Estadio Félix Capriles, Cochabamba (A) Bolivia 1–2 (3–5p) Copa Paz del Chaco V. Ferreira — 398 10 June 1993 Estadio Azteca, Mexico...
Click to read more »Plant Systematics and Evolution, 266 (1–2): 5–43, Bibcode:2007PSyEv.266....5P, doi:10.1007/s00606-007-0539-9, S2CID 16578516 Lepší, M.; Lepší, P.; Koutecký...
Click to read more »London, Midland and Scottish Railway → British Railways Power class SDJR: 5P/5G LMS: 7F Numbers S&DJR: 80–90 LMS: 9670–9680 after 1932: 13800–13810 BR:...
Click to read more »August 2026. Purgathofer, A; Weinberger, R (1980). "A Huge New Nearby Planetary Nebula". Astronomy & Astrophysics. 87: L5–L6. Bibcode:1980A&A....87L...5P....
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. S2CID 16578516. Note that this publication...
Click to read more »SENTINEL-3a LEOP & COM 2016 EXOMARS TGO 2016 SENTINEL-5p 2017 SENTNEL-2b 2017 SMALL GEO ...
Click to read more »(plaque) R2-4P Minimum speed limit (plaque) R2-4a Combined speed limit R2-5P Unless otherwise posted (plaque) R2-5aP Citywide (plaque) R2-5bP Neighborhood...
Click to read more »Qualifying round 1 SF Servette 3–0 Matéo 2 Qualifying round 1 F Roma 0–0 a.e.t. (4–5p) 2023–24 Qualifying round 1 SF Kryvbas Kryvyi Rih 4–0 Dufour 3, Korošec Qualifying...
Click to read more »Shilling (1/– or 5p, £1⁄20) 1970 31 July 1990 The shilling and florin remained legal tender after decimalisation with respective values of 5p and 10p, the...
Click to read more »Prima Pramac Racing Ret2 58 Ret3 44 21 23 11 56 F 66 73 35 1P 1 21 1P 1 Ret1 5P F 1P 1 42 101 Ret1 428 3 Marco Bezzecchi Ducati Mooney VR46 Racing Team 3...
Click to read more »Kirkus Reviews; 15 October 2003, Vol. 71 Issue 20, p1276, 1/5p] Publishers Weekly; 27 October 2003, Vol. 250 Issue 43, p71-71, 1/5p Museum of Tolerance...
Click to read more »log4j.PatternLayout"> <param name="ConversionPattern" value="%d{ABSOLUTE} %5p %c{1}:%L - %m%n" /> </layout> </appender> <!-- loggers of category 'org.springframework'...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Archived 2013-03-03 at the Wayback Machine https://www.dco.uscg.mil/Portals/9/DCO%20Documents/5p/CG-5PC/CG-CVC/CVC3/cfsac/meetings/2016/Finalchapter5.pdf...
Click to read more »Revisiting Music Theory: Basic Principles. Taylor & Francis Group, 2016. 5p. Sauveur, Joseph. Principes d'acoustique et de musique, ou système général...
Click to read more »April 2022. "MP launches campaign to cut price of Freddo chocolate bar to 5p". BBC News. 11 October 2024. Retrieved 11 October 2024. Official website...
Click to read more »the circulating British coinage from mid-2008. The designs for the 1p, 2p, 5p, 10p, 20p and 50p coins depicted sections of the Royal Shield that formed...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Team 1 Agg.Tooltip Aggregate score Team 2 1st leg 2nd leg Anderlecht 1–3 Steaua București 1–0 0–3 IFK Göteborg 3–3 (4–5p) Barcelona 3–0 0–3...
Click to read more »have a sparkling reputation themselves), and the allocation of power class '5P' by the LMS was hardly deserved. Within a few years they had been relegated...
Click to read more »Children (ALSC). Kirkus Reviews, 9/1/2005, Vol. 73 Issue 17, p 978-978, 1/5p. (Book Review) Publishers Weekly, 1/16/2006, Vol. 253 Issue 3, p 68-68, 1/3p...
Click to read more »Decay "Part One" Peter Moffatt Terrance Dicks 22 November 1980 (1980-11-22) 5P 5.8 — "Part Two" 29 November 1980 (1980-11-29) 5.3 — "Part Three"...
Click to read more »152.10 January 10–15, 2020 2020 Winter Youth Olympics – Team – 5 91.35 7T/5P January 10–15, 2020 2020 Winter Youth Olympics 6 46.96 5 94.65 5 141.61 September...
Click to read more »{\displaystyle P(Y>X)+0.5P(Y=X)=0.5} against the alternative hypothesis P ( Y > X ) + 0.5 P ( Y = X ) ≠ 0.5 {\displaystyle P(Y>X)+0.5P(Y=X)\neq 0.5} , without...
Click to read more »established as a photographic squadron flying the PB4Y-1P Liberator and F6F-5P Hellcat. Squadron personnel were assembled at NAAS Camp Kearney, California...
Click to read more »1974 as the previous issue remained in use. The new issue had four values: 5p – Old Grammar School, Castletown 10p – Tynwald Hill 25p – St German's Cathedral...
Click to read more »September Flag 11–1 Haka 9–0 2–1 Aris 2–6 Chelsea 1–1 1–5 Aberdeen 4–4 (4-5p) Budapest Honvéd 3–1 1–3 (a.e.t.) Manchester City 2–2 (a) Linfield 1–0 1–2...
Click to read more »also participates in earth observation missions, such as ENVISAT, Sentinel-5p and PACE. SRON-researcher Ilse Aben received the Stevin Prize in 2025 for...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »pilot was to manipulate the controls to excite 0.5P oscillations (or half-P hop) in the rotor; 0.5P is a vibration that happens once per two main rotor...
Click to read more »tolls. Other classes of traffic remain subject to tolls. The tariff starts at 5p in the case of cars (without other vehicle or trailer under tow). Campaigns...
Click to read more »OS2U Kingfisher BU0951 Korean War era Douglas AD-4N Skyraider Grumman F9F-5P Panther 126275 North America F-86L Sabre 512993 Piasecki CH-21 515859 Vietnam...
Click to read more »7″: Epic / 07-5p-336 (Japan) No. Title Length 1. "Everything She Wants" (remix) 5:32 2. "Like a Baby" 4:12 3. "Message from Wham!" ...
Click to read more »Sentinel-3A (Feb 2016) Sentinel-1B (Apr 2016) Sentinel-2B (Mar 2017) Sentinel-5P (Oct 2017) Sentinel-3B (Apr 2018) Sentinel-6A (Nov 2020) Sentinel-2C (Sep...
Click to read more »Sascha Bert 2010-11 Auto Bild Sportscars (11/2010), Continental Sport Contact 5P. 20,600 m 7:45 Audi R8 Plus (Mk1, Type 42, 2013, N/A 5.2, 550 PS) Horst von...
Click to read more »Lorraine 3B licence-built Potez 3B? Lorraine 3D licence-built Potez 3B Lorraine 5P Ecole – 5 cyl radial Lorraine 6A – (AM) 110 hp Lorraine 6Ba – 6 cyl two-row...
Click to read more »worldfootball.net. Retrieved 24 November 2014. "Sao Paulo vs Velez Sarsfield 1–0 (3-5p) Libertadores 1994 Final" (in Portuguese). youtube. Archived from the original...
Click to read more »introduces viewer Gillian Turner who loves Ant but hates Dec, a man refuses to pay 5p for a carrier bag at a supermarket by stuffing his items on his body, suggests...
Click to read more »coal at them. Samuel granted union recognition and wage increase from 6d (2.5p) to 5 shillings' (25p) a week. When the workers attempted to return to work...
Click to read more »including national charities and local councils. "HARVEY NASH GROUP PLC ORD 5P Share Price - Shares - London Stock Exchange". Retrieved 11 September 2013...
Click to read more »Iijima, Yoshitsugu (April 1997). "来 島大橋 主塔5Pの 架 設 時制振 対 策" [Vibration Control Of Kurushima Bridge Tower 5p Under Construction]. 土 木 学 会 論 文 集 (in Japanese)...
Click to read more »aircraft sold to Chile. Mirage 5P : Export version of the Mirage 5 for Peru; 22 built. Mirage 5P Mara : Upgraded Mirage 5P for Argentina; 10 aircraft sold...
Click to read more »average busts and fairly straight bodies. Size may be denoted as "5JP" or as "5P". Women's petite For larger, shorter women, sometimes with lower bust lines...
Click to read more »The 5P-27 "Furke" is a ship-based 3D air and surface search radar system designed and produced by the VNIIRT (as a part of Almaz-Antey) for the Russian...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »as the greatest whales". Lethaia. 56 (2): 1–11. Bibcode:2023Letha..56..2.5P. doi:10.18261/let.56.2.5. ISSN 0024-1164. Sereno PC (1999). "The evolution...
Click to read more »Number & Name Type Photograph Livery Notes LMS 13065 LMS Class 5P/4F "Crab" 2-6-0 Built in 1927 at Crewe Works. Out of service for 2018, due to cracked...
Click to read more »are the non-negative number of 2p and 5p coins, respectively. A point on a line gives a combination of 2p and 5p for its given total (green). Multiple...
Click to read more »William Jones (William Siôn), brother of Owen. Vosper paid each model 6d. (2.5p) an hour for sitting. The eighth figure (second right of Siân Owen, wearing...
Click to read more »≡ 1 (mod p2): 11, 1006003 (OEIS: A014127) 4p − 1 ≡ 1 (mod p2): 1093, 3511 5p − 1 ≡ 1 (mod p2): 2, 20771, 40487, 53471161, 1645333507, 6692367337, 188748146801...
Click to read more »Izan Guevara Boscoscuro Blu Cru Pramac Yamaha Moto2 2 6 3 7 1P 3 7 6P 6 4 3 5P 155 3 Senna Agius Kalex Liqui Moly Dynavolt Intact GP 18P 19 1 1F 7 10 4 3...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Symbol penny p Denominations Banknotes £1, £5, £10, £20, £50 Coins 1p, 2p, 5p, 10p, 20p, 50p, £1, £2, £5 Demographics User(s) Isle of Man Issuance Treasury...
Click to read more »2014 Chainat Hornbill H 2–1 Rochela 28', Carmelo 43' Round of 32 9 July 2014 Bangkok Glass H 2–2 (a.e.t.) (3–5p) Theerathon 22', Maranhão 89' Round of 16...
Click to read more »Target Score Seed Location has-miR-4286 ACCCCACUCCUGGUACC 94 475 has-miR-3059-5p UUUCCUCUCUGCCCCAUAGGGUGU 88 199, 396 has-miR-3152 UGUGUUAGAAUAGGGGCAAUAA 87...
Click to read more »rebuilt with superheaters (see below) 1522 4-6-0 70 Horwich Works 1920–24 8 5P 10405–10474 Superheated, 15 were rebuilds. 1 0-2-2T 2 Kerr, Stuart & Co. 1905...
Click to read more »958 13.072 11.238 11.392 12.882 12.813 13.442 13.618 14.763 15.877 16.942 17.970 18.974 19.960 20.934 21.893 5p 8.470 9.102 9.995 10.809 11.612 12.425...
Click to read more »Emirates Ukraine Argentina: Magic 1 on the Mirage IIIEA, Dagger, Mirage 5P Mara and Super Étendard. Australia: Magic 1 on the Mirage IIIO. Brazil:...
Click to read more »Jenkinson, Dave; Emergency Librarian, Vol. 19 Issue 2 (Nov/Dec 1991), p66, 5p. "A Darker Magic by Michael Bedard". Kirkus Reviews. Contemporary; undated...
Click to read more »(Austria/France 2026) – VistaRama65 / 27 perforation time-lapse camera for 70mm/5p reduction prints Journey to the Stars (1962) – Cinerama 360 (a 10/70 dome...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Shave), MR-212/201-1 (Palm Frond), Nucleus-2 6000A Fire control radar: JSC 5P-10 Puma FCS, 3R14N-11356 FCS, MR-90 Orekh SAM FCS Sonar: MGK-335EM-03 sonar...
Click to read more »1969 decimal coins which had precise equivalent values in the old currency (5p, 10p, 50p – 1, 2, and 10 shillings respectively) were introduced, while decimal...
Click to read more »7 3 14 7 3 5 NC RetF 5 8 1 14 5 2 4 Callum Ilott 1 9 5 5 8P 2 5 Ret 1P 6 5P 8 10 Ret 6P 1 12 6 3 7 2P 16 5 10 2021 BHR SP1 BHR SP2 BHR FEA MCO SP1 MCO...
Click to read more »radar: Multi-purpose AESA naval radar mast/system "Zaslon" Fire control radar: 5P-10 Puma for A-190 100 mm artillery Sonar: Zarya-M bow mounted. Vinyetka low...
Click to read more »in the mode. This mode is not available on the Facebook version. In Sprint 5P, the player plays against four others players in the basic Sprint Mode. The...
Click to read more »Georgia FC Zestaponi 2–2 aet 2–1 4–3 3Q Bosnia FK Sarajevo 2–1 1–2 3–3(4-5p) 2011–12 UEFA Europa League 3Q Israel Bnei Yehuda 3–0 0–1 3–1 Play-Off Belgium...
Click to read more »needed] On Monday 29 November 2004, shares in Courts plc were suspended at 13.5p and the company went into administration, with debts of £280 million. PwC...
Click to read more »Marques (BRA) 4 2 5 Saleh El-Sharabaty (JOR) 1 12 12 Henrique Marques (BRA) 4 5P 4 Seo Geon-woo (KOR) 4 9 8 8 Mehran Barkhordari (IRI) 2 13 12 9 Jasurbek...
Click to read more »Group Stage Inter Miami 0–4 Cruz Azul 1–1 (4–5p) 2024 Group Stage D.C. United 3–3 (5–6p) Santos Laguna 0–0 (3–5p) 2025 League Stage Necaxa 1–3 UNAM 2–3 Atlas...
Click to read more »BBC News. "MP launches campaign to cut price of Freddo chocolate bar to 5p". BBC News. 2024-10-11. Retrieved 2024-10-11. Perera, Shehan (2024-12-11)...
Click to read more »List of congenital disorders 47,XXY - see Klinefelter syndrome 5p syndrome - see Cri du chat syndrome Acrania Achondroplasia Acrocephalosyndactyly Apert...
Click to read more »the same year Smint started a partnership with Breast Cancer Care, donating 5p to the charity for every pack of strawberry Smint sold. In 2006, Smint and...
Click to read more »Class D16/1; another one under construction 10412 ex-L&YR Class 8 7 4-6-0 5P 10617 ex-L&YR Hughes Railmotor 1 N/A not classified Railmotor; BR Number never...
Click to read more »Minister's Cup Gunemba (2) — 164 23 November 2025 Sir John Guise Stadium, Port Moresby (N) Vanuatu 2–2 (4–5p) 2025 MSG Prime Minister's Cup A. Kepo, Paul —...
Click to read more »depending on the location of the seats, between one and three shillings (5p to 15p). Speech at Bedford, 20 July 1957 See, for example, Curtis A. Amlund...
Click to read more »Municipal 1–2 3–2 Alianza Atlético 3–3 (1–3p) Universitario 2–1 1–2 Cienciano 3–3 (4–5p) Unión Huaral 3–0 0–3 Deportivo Sipesa 5–4 Sporting Cristal 3–2 2–2...
Click to read more »Heavy, He's My Brother) The Box (parody of The Cube) Raymond must get the 5p coin out from the bottom of the bag. Advert: Pearly Chimp. The Diddy Step...
Click to read more »target detection and designation radar Pozitiv-ME1 air/surface search radar 5P-10E Fire Control Radar Anapa-ME1 sonar Moskit-E 3Ts-81E missile fire control...
Click to read more »CAS Number 54466-01-2 Y 3D model (JSmol) Interactive image InChI InChI=1S/5P.Sm Key: BOIVIBBFKRHHPN-UHFFFAOYSA-N SMILES [Sm].[P].[P].[P].[P].[P] Properties...
Click to read more »Russia Lion of Babylon (tank) Iraq 100 M-84/M-84A Yugoslavia 9 Chieftain Mk-5P United Kingdom 75 Vickers MBT Mk1 United Kingdom 75 M47M Patton United...
Click to read more »408 MHz". Monthly Notices of the Royal Astronomical Society. 202 (1): 1P–5P. doi:10.1093/mnras/202.1.1p. ISSN 0035-8711. Kronberg, P. P. (1986-04-01)...
Click to read more »for England. Retrieved 4 November 2025. White, Rob (3 August 2024). "The 5p toll bridge that earns a tax-free fortune". The Daily Telegraph. Retrieved...
Click to read more »volatility of the underlying commodity prices. At the time of the original 5p price rise, the company who owns Space Raiders are known as KP Snacks. In...
Click to read more »Companies House. Retrieved 30 January 2024. "Murray International Trust PLC ORD 5P". Trustnet. Retrieved 22 March 2024. "FTSE 250 Index Factsheet". FTSE Russell...
Click to read more »December 2003 200p August 2004 43p December 2004 9p December 2005 8.5p March 2010 2.071865p...
Click to read more »series Y3 (Y360) 3 II 2017 2018 Y5 (Y560) 5c 5 II 2017 2018 Prime lite 2019 5p Y6 6 Pro 6 II Compact 2017 Pro 2018 Prime 2019 Prime Pro 6s 6p Y7 7 Prime...
Click to read more »2018. "Артиллерийский комплекс "А-192–5П–10Э"" [Artillery complex "A-192-5P-10E"]. Concern Morinformsystem-Agat (in Russian). Archived from the original...
Click to read more »with the delivery of their parcels. The company allowed customers to donate 5p for a delivery for the United Kingdom, or 10p for an international delivery...
Click to read more »zone (usually under an R2 speed limit sign) W16-5p (D) Supplemental arrow to the right (plaque) W16-5p (I) Supplemental arrow to the left (plaque) W16-6p...
Click to read more »Kong came off the silver standard, the Straits dollar was worth 2s 4d (11.5p approx) sterling, whereas the Hong Kong dollar was worth only 1s 3d sterling...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »JT AIR OREGON Portland 1978 1981 Merged with Horizon Air. Air Pac Alaska 5P APM ALASKA PACIFIC Dutch Harbor 1982 1986 Renamed Air Pacific[citation needed]...
Click to read more »research has identified miR-139-5p, a small noncoding RNA, as a potential tumor suppressor in melanoma. Overexpression of miR-139-5p has been shown to inhibit...
Click to read more »{\displaystyle 5P_{3/2}\ F=4} state. Once in the excited state, the atom is forbidden from decaying to any of the 5 P 1 / 2 {\displaystyle 5P_{1/2}} states...
Click to read more »the circulating British coinage from mid-2008. The designs for the 1p, 2p, 5p, 10p, 20p and 50p coins depict sections of the Royal Shield that form the...
Click to read more »3 5 4F Ret 40 7 Pacharagorn Thonggerdloung 4 7 8 8 38 8 Haruki Matsuyama 5P F RetP 6 4F 34 9 Noprutpong Bunprawes 8 11 12 9 24 10 Muh Badly 14 6 10 11...
Click to read more »sponsored Formula Ethara team 'Jack-O-Racers' for the competition. Sharp 5P-37G boombox Sharp EL-546R scientific calculator Sharp CD-S400 Hi-Fi stereo...
Click to read more »Twizzle originally lived in a toy shop and cost two shillings and six pence (12.5p) and was nearly sold to a naughty girl named Sally Cross but he hid and escaped...
Click to read more »August 2008 Match 1 Olympique Khouribga Père-Jégo Stadium, Casablanca 1–1 (4–5p) Mohsine Moutouali 90' Report 30 August 2008 Match 2 Kawkab Marrakesh Père-Jégo...
Click to read more »shillings and sixpence (37.5p) for full members and half-a-crown (12.5p) for under-18s. There was a match levy of sixpence (2.5p). Players had to supply...
Click to read more »The LMS gave them the numbers 11110–11119, and the power classification 5P. Another 20 of this class were ordered but turned out as further examples...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »(5), D (63), E (18), F (10), G (92) Claughton 4-6-0 130 Crewe Works 1913–21 5P 5900–6029 Superheated, 42 later 'renewed' as Patriots by LMS MM 2-8-0 30 R...
Click to read more »2 McLaren-Mercedes 22 1P 5 13 3 2 1 RetP 10 1 1P 5P 2 3P 7 3 12P 1PF 5 151 23 5F 3 5F Ret 12 8 9 4 5P 5 1 4 10 2 10 Ret Ret 7 3 BMW Sauber 3 2 6F 4 9 5...
Click to read more »1 ( 0 ) + 2 / 5 p 2 ( 0 ) + 1 / 5 p 3 ( 0 ) {\displaystyle 2/5p_{1}(0)+2/5p_{2}(0)+1/5p_{3}(0)} . In words, independently of the initial beliefs, individuals...
Click to read more »S, Garabadgiu AV, Melino G, Candi E (2014). "MicroRNAs, miR-154, miR-299-5p, miR-376a, miR-376c, miR-377, miR-381, miR-487b, miR-485-3p, miR-495 and miR-654-3p...
Click to read more »South Shields, County Durham. Juliana United Kingdom The ship wrecked at 5p.m. at Green Point, Cape Town, in perfectly clear weather. Her crew and the...
Click to read more »Ohuchida K, Mizumoto K, Fujita H, Nakata K, Tanaka M (2010). "MicroRNA miR-17-5p is overexpressed in pancreatic cancer, associated with a poor prognosis and...
Click to read more »Team 2 1st Bangor Old Boys 2–3 Newington Youth Club Albert Foundry 1–1 (4–5p) Ballymoney United Ards Rangers 3–1 Oxford United Stars Ballinamallard United...
Click to read more »Gravitational Radiation". Monthly Notices of the Royal Astronomical Society. 156: 1P–5P. arXiv:0810.3908. Bibcode:1972MNRAS.156P...1J. doi:10.1093/mnras/156.1.1p...
Click to read more »Semifinals Final 3 Valletta 5 4 4 Hamrun 1 2 1 Luxol 1 2 (4p) 2 Valletta 5 2(5p) 1 Luxol 6 4 2 Swieqi 1 1...
Click to read more »MicroRNA-146a-5p (miR-146a-5p) indirectly represses IL-8 expression by silencing IRAK1. Among multiple microRNAs (miRs), miR-146a-5p has been identified...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. S2CID 16578516. Archived from the original...
Click to read more »Ret Ret Ret 11† 4 3 3 6 12† 3 23 6 Keke Rosberg Ret 4 5† 2 Ret 4 Ret 4 Ret 5P† Ret 9† 4 Ret Ret Ret 22 7 Gerhard Berger 6 6 3 Ret 10 Ret Ret Ret Ret 10F...
Click to read more »Sentinel-3A (Feb 2016) Sentinel-1B (Apr 2016) Sentinel-2B (Mar 2017) Sentinel-5P (Oct 2017) Sentinel-3B (Apr 2018) Sentinel-6A (Nov 2020) Sentinel-2C (Sep...
Click to read more »Telford Gardens ↺ Hung Hom 5M Kai Tak (Tak Long Estate) ↺ Kowloon Bay station 5P Tsz Wan Shan (Central) ↔ Star Ferry Peak hours only 5R Kai Tak Cruise Terminal...
Click to read more »camera. In 1959–1960, 129 MiG-17PF interceptors were produced as the Lim-5P. WSK-Mielec also developed several Polish strike variants based on the MiG-17:...
Click to read more »3P, in kg; where P is the rated engine(s) power in kilowatts; MU = 175 + 0.5P, in lb; where P is the rated engine(s) power in brake horsepower (bhp). For...
Click to read more »administration By mouth Drug class Antimineralocorticoid Identifiers IUPAC name (5P)-1-(2-hydroxyethyl)-N-[4-(methanesulfonyl)phenyl]-4-methyl-5-[2-(trifluor...
Click to read more »won the Campionato Sammarinese di Calcio in 1988 winning on penalties (6-5p) against S.S. Virtus in the play-off finals after a 3–3 draw. In 1989, S.P...
Click to read more »(Dan Maff and Shawn Donavan) by pinfall Crockett Cup first round match 7:16 5P SVGS (Jax Dane and Blake "Bulletproof" Troop) (with Chris Silvio, Esq.) defeated...
Click to read more »the short (p) arm of chromosome 5. This chromosomal change is written as 5p-. The signs and symptoms of cri-du-chat syndrome are probably related to the...
Click to read more »Bp. Spartacus Játékcsarnok, Budapest 16 December 1972 15th 1973 Veszprém (5p) 4 roundmatches Ferencváros (4p) Tata 20 November 1973 16th 1974 Vasas 13–8...
Click to read more »the "blocks" in the periodic table: 1s, 2s, 2p, 3s, 3p, 4s, 3d, 4p, 5s, 4d, 5p, 6s, 4f, 5d, 6p, 7s, 5f, 6d, 7p The "periodic" nature of the filling of orbitals...
Click to read more »remained in force until 1783, when they were replaced by a one-shilling (5p) toll whichever channel the boats used. Users of the Trent and Mersey Canal...
Click to read more »Burkina Faso Ivory Coast 2-0 Niger 2008 Details Mali Ivory Coast 1-1 (6-5p) Mali 2009 Details Benin Senegal 1-0 Niger 2010 Details Niger Niger 1-0...
Click to read more »suffix -5p (from the 5′ arm) (e.g. miR-155-5p) and -3p (from the 3′ arm) (e.g. miR-155-3p) following their name (see Figure 3). Once miR-155-5p/-3p is...
Click to read more »Public Transportation Route Stop KMB/Citybus 3B, 5C, 5P, 5X, 6D, 6P, 106, 106A, 106P, 111, 116, E23, E23A, N23, N121, N216 Choi Hung Road Playground 5...
Click to read more »Chieftain tanks was in fact to Iran, which took delivery of 707 Mk-3P and Mk-5P (the letter P standing for Persia), as well as 187 FV4030-1, 41 ARV and 14...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »the circulating British coinage from mid-2008. The designs for the 1p, 2p, 5p, 10p, 20p and 50p coins depict sections of the Royal Shield that form the...
Click to read more »position an accessory flash like the AF400FTZ away from the camera via the 5P Sync Cord. It also provides an easier access to the shutter release button...
Click to read more »Eider 12H Pétrel 12Rcr Radium 12R Sterna 18G Orion Radial piston engines 5P 7M Mizar 9N Algol 14A 18F Sirius See also: Lorraine-Dietrich aero-engines...
Click to read more »Smithers, Rebecca (29 July 2016). "England's plastic bag usage drops 85% since 5p charge introduced". The Guardian. Archived from the original on 8 September...
Click to read more »"E164". At element 118, the orbitals 1s, 2s, 2p, 3s, 3p, 4s, 3d, 4p, 5s, 4d, 5p, 6s, 4f, 5d, 6p, 7s, 5f, 6d and 7p are assumed to be filled, with the remaining...
Click to read more »0871 2xx xxxx to 0871 9xx xxxx Up to 8.5p a minute (plus VAT) but fixed (e.g. always 6p/minute or always 8.5p/minute) from BT landline, other providers...
Click to read more »Bratislava 1–3 1–1 2−4 2024–25 3Q Dinamo Minsk 0–2 2–1 2−3 2025–26 3Q Noah 1–1 0–0 (a.e.t.) 2−3 (6–5p) PO Braga 0–4 1–5 1−9 2026–27 3Q Omonia 6 Aug 13 Aug...
Click to read more »5-alpha-Oxoprolinase deficiency, rare (NIH) 5-Nucleotidase syndrome, rare (NIH) 5p minus syndrome 5q- syndrome 6 alpha mercaptopurine sensitivity, rare (NIH)...
Click to read more »7 4F 5 3 15† Ret 2PF Ret 2P 3 2F 199 4 Lewis Hamilton 5 3 3P 5 12 4 3 4P 5P 1P 3P 9F 5 5 Ret 6 7 4 9 189 5 Kimi Räikkönen 1F 7 2 2 2 10 9 5 2 2 Ret 11...
Click to read more »target detection and designation radar Pozitiv-ME1 air/surface search radar 5P-10E Fire Control Radar Anapa-ME1 sonar Moskit-E 3Ts-81E missile fire control...
Click to read more »A-190E 100mm gun first used in the Talwar-class frigates is controlled by a 5P-10E system that can track four targets simultaneously. Protection from air...
Click to read more »Astrophysical Journal. 902 (1): L5. arXiv:2008.08587. Bibcode:2020ApJ...902L...5P. doi:10.3847/2041-8213/abb952. ISSN 0004-637X. Orbital Mechanics (Rocket and...
Click to read more »from 1816 until 1990, when it was demonetised in favour of a new smaller 5p coin of the same value. At decimalisation in 1971, the shilling coin was superseded...
Click to read more »history on the evolution of TOI-849b". Astronomy & Astrophysics. 654: L5. arXiv:2110.09364. Bibcode:2021A&A...654L...5P. doi:10.1051/0004-6361/202141734....
Click to read more »(2 – 3p) 40,000 22 August 2010 Juventus H 0 – 0[permanent dead link] (4 – 5p) 35,000 25 August 2010 Barcelona A 1 – 1 (1 – 3p) Inzaghi 67' 96,195 2 January...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »as the greatest whales". Lethaia. 56 (2): 1–11. Bibcode:2023Letha..56..2.5P. doi:10.18261/let.56.2.5. ISSN 0024-1164. S2CID 259782734. Bianucci, Giovanni;...
Click to read more »19m 24.467s Declination +16° 43′ 01.02″ Apparent magnitude (V) 5.9p — 18.5p Astrometry Distance 3500 pc Characteristics Variable type nova Other designations...
Click to read more »1–1 (a.e.t.) (6–5p) 1993 Copa América Rodríguez 25,000 646 1 July 1993 Estadio Monumental, Guayaquil (N) Colombia 0–0 (a.e.t.) (6–5p) 1993 Copa América...
Click to read more »Salernitana 0 1 1 Fiorentina Fiorentina 5 3 8 bye Fiorentina 6 1 7 Brescia 2 1 3(5p) Brescia 0 3 3 Vicenza 1 2 3(4p) Brescia 0 2 2 Juventus Juventus 0 1 1 bye...
Click to read more »2 December 2010 Iraq 2 – 2 4-5p Kuwait May 22 Stadium, Abyan...
Click to read more »and recombination. Enoxacin inhibits the expression of the microRNA mir-34-5p, leading to an increase in the lifespan of the nematode C. elegans. Enoxacin...
Click to read more »as the greatest whales". Lethaia. 56 (2): 1–11. Bibcode:2023Letha..56..2.5P. doi:10.18261/let.56.2.5. Romano, Marco; Bellucci, Luca; Antonelli, Matteo;...
Click to read more »Jasurbek Jaysunov (UZB) D Q Stefan Takov (SRB) 5 9 4 Rami Eissa (EGY) 10 5P Marko Golubić (CRO) 3 10 4 Maickol Orozco (DOM) 3 0 Rami Eissa (EGY)...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Central 2–2 (4–5p) São Paulo 1–0 1–2 Deportivo Táchira 5–2 Nacional 3–0 2–2 Santos Laguna 2–2 (3–4p) River Plate 0–1 2–1 LDU Quito 4–4 (3–5p) Santos 4–2...
Click to read more »in June 1992. Demon allowed users in Hull to make untimed calls for just 5.5p (+ VAT) to access the Internet via dialup accounts. Karoo's dial-up service...
Click to read more »Decay "Part One" Peter Moffatt Terrance Dicks 22 November 1980 (1980-11-22) 5P 5.8 — "Part Two" 29 November 1980 (1980-11-29) 5.3 — "Part Three"...
Click to read more »rare, their P-bonded coordination complexes are well established, e.g. Mo(CO)5P(OH)3. Tertiary phosphine oxides, compounds with the formula R3PO cannot tautomerize...
Click to read more »Gavin. (1998). "Toy Stories" Film Comment Nov/Dec98, Vol. 34 Issue 6, p28, 5p Russell, Catherine (2010). "Autoethnography". Experimental Ethnography: The...
Click to read more »1–0 5–1 Deportes Ovalle 4–1 Trasandino 2–0 2–1 Provincial Talagante 2–2 (4-5p) Pudahuel Barrancas 1–1 1–1 Deportes Melipilla 1–5 San Antonio Unido 0–1 1–4...
Click to read more »A-190E 100 mm gun first used in the Talwar-class frigates is controlled by a 5P-10E system that can track four targets simultaneously. Protection from air...
Click to read more »fraction with an optional exponent indicator, followed by F) 0x.5FP0F, 0x.5P-6f (0x followed by a hexadecimal fraction with a mandatory exponent indicator...
Click to read more »in a warm aquarium, ideally around 80 °F (27 °C), with soft and acidic (<6.5pH) water. Though angelfish are members of the cichlid family, they are generally...
Click to read more »declined 97% since 2014, with a great share of the decline occurring after the 5p charge was introduced in 2015. Wales introduced a legal minimum charge of...
Click to read more »instead. It was his first stable job in his life with a ten-months a year, 9-5p schedule. His recurring role in NCIS: Los Angeles was upgraded to a series...
Click to read more »its name is: Forget-me-not. Westerly; Jun2013, Vol. 58 Issue 1, p232-236, 5p ISSN 0043-342X Azar, Shokoofeh (2020). L'illuminazione del susino selvatico...
Click to read more »intermittent. Total receipts for 1948 amounted to £1630, with fares of 6d (2.5p) for adults and 3d (1.25p) for children suggests a ridership of about 98,000...
Click to read more »London and North Western Railway → London, Midland and Scottish Railway Power class LMS: 5P, 5XP ‡† Withdrawn 1929–1941, 1949 Disposition All scrapped...
Click to read more »3–0 3–1 Bangkok University 1–1 2–1 Quarter-finals Sepahan 0–0 0–0 0–0 (4–5p) 2009 AFC Champions League Group H Pohang Steelers 0–2 1–1 2nd Tianjin Teda...
Click to read more »9–0 Round of 16 Verona 3–1 f 5–1 8–2 Quarter-final Frankfurt 1–0 a.e.t. (4p–5p) 0–1 f 1–1 2016–2017 Round of 32 Breiðablik Kópavogur 1–0 f 0–0 1–0 Round...
Click to read more »used as separator; APPORTIONED screened in blue at top. none P1 2345 1234 5P 1234 P5 P0 0000 to P9 9999; 0000 0P to 9999 9P; 0000 P0 to 0014 P1 (As of...
Click to read more »Plant Systematics and Evolution, 266 (1–2): 5–43, Bibcode:2007PSyEv.266....5P, doi:10.1007/s00606-007-0539-9, S2CID 16578516 [Referring to the subfamily...
Click to read more »(The Mermaid Who Couldn't Swim), 5p., PLG no. 37, 2003. De zeemeermin die niet kon zwemmen (The Sea Mermaid Can't Swim), 5p., Zone 5300 no. 10, 2003. Lellebel...
Click to read more »Sentinel-3A (Feb 2016) Sentinel-1B (Apr 2016) Sentinel-2B (Mar 2017) Sentinel-5P (Oct 2017) Sentinel-3B (Apr 2018) Sentinel-6A (Nov 2020) Sentinel-2C (Sep...
Click to read more »mAh Rear camera 13 megapixel f/2.2, focus range 0.1m~infinity, lens number 5P, lens size 1/3.2", dual flash and autofocus Front camera 5 megapixel f/2.4...
Click to read more »Park County, Wyoming." Pro. Amer. Philos. Soc, 83, p. 217-340, 21 figs., 5p ls. Krause (1977), "Paleocene multituberculates (Mammalia) of the Roche Percee...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. S2CID 16578516. [Referring to the subfamily...
Click to read more »Newcastle Town (D1) 0 1 1 Prescot Cables (D1) 0 1 1 Newcastle Town (D1) 0 5p Skelmersdale United (D1) 0 6p Fleetwood Freeport (D1) 1 0 1 Skelmersdale United...
Click to read more »music towards active rock. The Buzz moved to 105.7 FM on January 1, 2014, at 5p.m., taking the spot of sister station WMKS. WVBZ adopted the Top 40 format...
Click to read more »ℓ ( 4 m 2 + a 2 ) − 5 p − 2 m 2 , {\displaystyle b=\ell \,(4m^{2}+a^{2})-5p-2m^{2}\;,} c = 1 2 [ b ( a + 4 m ) − p ( a − 4 m ) − a 2 m ] . {\displaystyle...
Click to read more »sentimental ballad Hindustani classical semi-classical Instruments Vocals piano guitar Labels Coke Studio 5P Records Rearts Records Ali Mustafa Productions...
Click to read more »scoring system Result Fail Pass Score 0 1 2 3 4 5 6 7 8 9 10 Range <0.5P 0.5P–0.6P 0.6P–0.7P 0.7P–0.8P 0.8P–0.9P 0.9P–P P–1.1P 1.1P–1.2P 1.2P–1.3P 1...
Click to read more »Complement 52 Sensors & processing systems 5P-26M1 Pozitiv-M1 phased array radar system MP-231-2 navigation radar 5P-10-03 Laska fire control system МР-123-02...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. Note that this publication pre-dates the 2011...
Click to read more »class of mixed traffic moguls known as "crabs". Class 5MT "Crab" 2-6-0 Class 5P Dreadnought tank 4-6-4T, Designed for L&YR, built by the LMS. He also built...
Click to read more »Locomotive shed, Vadodara based WAP-5 or Locomotive shed, Valsad based WAG-5P. The train shares its rake with 59037/59038 Virar - Surat Passenger, 59040...
Click to read more »orbitals are kept together. [1s] [2s,2p] [3s,3p] [3d] [4s,4p] [4d] [4f] [5s, 5p] [5d] etc. Each group is given a different shielding constant which depends...
Click to read more »whose costs also increased – rising from 2.3p per hour the previous year to 2.5p per hour, therefore equal to 1Xtra. The audience Appreciation Index figure...
Click to read more »Buses: No. 2F, 3B, 3C, 3D, 5C, 15A, 116. Specific time services for 3X, 5P, 302, 302A, A23, E23 & E23A. Minibuses (Scheduled Services / Green Minibus):...
Click to read more »over het West-Brabantse geslacht Elsevier (A.M. Bosters. Voorburg, 2000, 5p) C.E.G. ten Houte de Lange, Stockmans, Stokmans, Elsevier Stokmans, Elzevier...
Click to read more »cancer stem cell proliferation and self-renewal by blocking microRNA-202-5p-mediated ANP32E inhibition". Journal of Translational Medicine. 19 (1): 400...
Click to read more »tank. Mobarez Main battle tank 100 United Kingdom Iran 707 Mk-3P and Mk-5P, 125–189 FV-4030-1, 41 ARV and 14 AVLB obtained before the 1979 revolution...
Click to read more »Bibliothèque nationale de France. The text is given in J. Dumont, Corps diplomatique 5p. 453. Holt (1988). New York Public Library. 1985. The Baltimore Literary and...
Click to read more »"AUSTER J-5P AUTOCAR UK 1953". Darwin Aviation Museum. 19 April 2017. Retrieved 5 July 2020. "Airframe Dossier - Taylorcraft-Auster J/5P Aiglet Trainer...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »120p. 2nd edition: Stuttgart: Franckhsche Verlagshandlung, 1905 18x12cm 91, 5p. 3rd edition: Stuttgart: Franckhsche Verlagshandlung, 1905 18x12cm 91p. List...
Click to read more »Independents. Dead-heat 10p: 14th Edman (4th x 2), 15th A. Chi Hong (4th x 1) 5p: 17th L. Molo (4th x 1), 18th O. Hidalgo (5th x 1) 2p: 21st M. De Villota...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. S2CID 16578516. [Referring to the subfamily...
Click to read more »appear regularly on Scottish and later British coinage until 2008, when a 5p coin design showing "The Badge of Scotland, a thistle royally crowned" ceased...
Click to read more »original on 1 May 2013. Retrieved 26 January 2013. For example: "HP LaserJet 5P and 5MP Printers — Product Specifications". HP Business Support Center. Hewlett-Packard...
Click to read more »milk: A rich opportunity". Nature. 468 (7327): S5-7. Bibcode:2010Natur.468S...5P. doi:10.1038/468S5a. PMID 21179083. Miller E (2018). "Beyond Passive Immunity...
Click to read more »in 2025". Advances in Atmospheric Sciences: 6737. Bibcode:2026AdAtS.tmp....5P. doi:10.1007/s00376-026-5876-0.{{cite journal}}: CS1 maint: bibcode (link)...
Click to read more »family of four could earn £180 in Nectar points per year. 8p/minute 4p/text 5p/1MB All came with Nectar points when topping up. Mobile by Sainsbury's operated...
Click to read more »coinage. Quantities of UK 1p and 2p coins may be referred to as "Copper", 5p, 10p, 20p, and 50p coins as "Silver" and £1 and £2 coins as "Bronze" due to...
Click to read more »Date Opponents H / A Result F–A Scorers Round 31 January 2017 Johor Darul Ta'zim H 1–1 (a.e.t.) (4–5p) Jaycee 120+1' Preliminary round 2...
Click to read more »Event SP FS Total 11–14 April 2019 2019 World Team Trophy 6 68.61 4 138.84 3T/5P 207.45 18–24 March 2019 2019 World Championships 9 70.42 8 138.16 8 208.58...
Click to read more »day. The toll was originally two shillings and sixpence, equivalent to 12.5p post-decimalisation, and approximately equivalent in purchasing power to £2...
Click to read more »miRNA. One such example is miR-455-5p which is edited by ADAR1. When ADAR is downregulated by CREB the unedited miR-455-5p downregulates a tumor suppressor...
Click to read more »to Disco 45 Songbook. It was originally priced at 1 shilling, changing to 5p post-decimalisation in issue #4 (March 1971). Disco 45 folded in July 1983...
Click to read more »Coach(FC) Both trains are hauled by a Locomotive shed, Vadodara based WAG-5P or Locomotive shed, Valsad based WAG-5. The train shares its rake with 59039...
Click to read more »Plant Systematics and Evolution. 266 (1–2): 5–43. Bibcode:2007PSyEv.266....5P. doi:10.1007/s00606-007-0539-9. Morgan, D.R.; Soltis, D.E.; Robertson, K.R...
Click to read more »www.russianspaceweb.com. Retrieved 23 December 2024. Anatoly, Zak. "Angara-5P launch vehicle". www.russianspaceweb.com. Retrieved 23 December 2024. Anatoly...
Click to read more »50 64 48 32 Pixel Size 1.12 μm 0.7 μm 0.8 μm 0.8 μm Lens Quantity 7P 4P 6P 5P ALC lens coating Yes Yes No No Optical Image Stabilization Yes Yes No No Electronic...
Click to read more »a cherry pie by local workmen who were caught and fined half a guinea (52.5p). However the most likely explanation is that it was placed there by the landlord...
Click to read more »Chiclayo OBW-1L FM 98.7 MHz 1 kW 2014 OBW-1F FM 89.7 MHz 1 kW 2015-2016 Ica OCW-5P FM 104.1 MHz 5 kW 2014-2016 La Oroya OAK-4Y FM 92.9 MHz 250 W 2014-2015 Lima...
Click to read more »binding sites were found for has-miR-147b, hsa-miR-203a-3p.1, and has-miR-214-5p miRNAs. The protein contains a domain of unknown function (DUF4594 from amino...
Click to read more »Repealed, Part 1, Irish Private Acts 1751 to 1800, 1781-82 (21 & 22 Geo. 3) c. 5P". Irish Statute Book. Retrieved 1 March 2023. Potts, James (1774). The Hibernian...
Click to read more »11 June 2026. Snuggs, Tania (21 May 2020). "New frog species the size of a 5p coin already 'critically endangered'". Sky News. Retrieved 11 June 2026. Virata...
Click to read more »are typically be redeemed in batches of 500, with each point being worth 0.5p. Points can also be redeemed with a number of partners through e-vouchers...
Click to read more »London by Longman, Hurst, Rees, Orme, and Brown. The price was 7s 6d (37.5p). It was not reprinted. A critical edition is due to appear in Volume 5 of...
Click to read more »Geography". Journal of Geography. 84 (1): 5–10. Bibcode:1985JGeog..84....5P. doi:10.1080/00221348508979261. Das, Raju J (March 2022). "What is Marxist...
Click to read more »agents of social control" Problems of Post-Communism #42 (Nov/Dec 1995): 5p. 15 Feb 1994 The Washington Times "WHPSI": The World Handbook of Political...
Click to read more »Wilstermann 4–0 0–0 2006 Copa Sudamericana First Round Colo-Colo 1–2 2–1 3–3 3-5p 2013 Copa Libertadores Group 8 Fluminense 1–3 1–1 3rd Place Grêmio 1–1 2–1...
Click to read more »yellowhammer Osborne Ross 540 2017.06.05 The Machin Definitive Anniversary 5p X 1: 1971; 20p X 1: 1990; 1st X 4: 1993, 2000, 2006, 2013; £1.00 X 1: 2017...
Click to read more »Sentinel-1B anomaly (update)". Sentinel Online. December 25, 2021. "Sentinel-5P". European Space Agency. Retrieved 14 May 2026. "Sentinel-6 Michael Freilich"...
Click to read more »Seville". Pinterest. Retrieved 20 March 2026. "Fruit & Nut chocolate bars 5p". Pinterest. Retrieved 17 April 2026. "Cadbury's Ice Breaker". Pinterest....
Click to read more »Among the mutations present in the tumour genome are trisomy in chromosome 5p, as well as several single base mutations, and short insertions and deletions...
Click to read more »expression. circSNX29 sponges miR-744 and circFGFR2 sponges miR-133a-5p and miR-29b-1-5p that promote myoblast differentiation. circSNX29 activates Wnt pathways...
Click to read more »Retrieved May 31, 2025. Independent School, Winter90, Vol. 49 Issue 2, p31, 5p Vice, Samantha (September 7, 2010). "How Do I Live in This Strange Place?"...
Click to read more »Chen J, et al. (September 2021). "Expression and significance of miR-30d-5p and SOCS1 in patients with recurrent implantation failure during implantation...
Click to read more »Astronomy and Astrophysics, 641: A5, arXiv:1907.12875, Bibcode:2020A&A...641A...5P, doi:10.1051/0004-6361/201936386 The Planck Collaboration (2020), "Planck...
Click to read more »2012 SF 4 August 18:35 Imtech Arena Hamburg, Germany Werder Bremen 2–2 (4-5p) 42,217 Shaqiri 27' Kroos 37' 60' Schweinsteiger 51' Mandžukić Kroos Ribéry...
Click to read more »at over 7,000 million litres per year. In 1974 a pint of milk was fixed at 5p, which was kept artificially-low during the late 1970s; by 1981 it had risen...
Click to read more »design bureau had developed the liquid-fuelled Kh-28 (AS-9 ‘Kyle’) and the KSR-5P (AS-6) anti-radiation missiles. They merged with Raduga in 1967, so Raduga...
Click to read more »100 Perforations 14 x 15 Gum PVA Dextrin. Stamps: 15.5p Stamp Tropical Island Tropical Island; 19.5p Stamp Desert Desert; 26p Stamp Temerate Farmland Temerate...
Click to read more »Parc des Sports des Maisons Rouges, Bry-sur-Marne (N) Guadeloupe 1–1 (6–5p) 2010 Coupe de l'Outre-Mer Hmaé — 200 25 September 2010 Stade Henri-Longuet...
Click to read more »2015-03-01. "13th Anniversary Live on Pay Per View - Sunday, March 1st 8e / 5p - ROH Wrestling". "411MANIA - The Bullet Club Added to the ROH 13th Anniversary...
Click to read more »Journal Letters. 895 (1): L5. arXiv:2004.14544. Bibcode:2020ApJ...895L...5P. doi:10.3847/2041-8213/ab8e47. "Welcome to the Neil Gehrels Swift Observatory"...
Click to read more »cents from Buffalo at 9:30a & 12:30a and returning from Lancaster at 1p and 5p. 1852 saw the Fair held in East Hamburgh, now Orchard Park. The 1853 Fair...
Click to read more »of iron 10p, 25p and 50p and 1 mk. This period also saw the issue of holed 5p and 10p coins. All coins below 1 markka had ceased to be produced by 1948...
Click to read more »Elmastaşoğlu (29) 1966/67 05-03-1967 Ali Sami Yen Galatasaray 1–1 Beşiktaş Özacar (5p) Elmastaşoğlu (49) 1967/68 07-01-1968 İnönü Beşiktaş 1–1 Galatasaray Özacar...
Click to read more »2021, using pay-as-you-go data without a "goodybag" doubled in price from 5p MB to 10p MB. In April 2022, giffgaff announced a UK price freeze for the...
Click to read more »q c P + 1 ) 2 7 − 1 ] {\displaystyle \mathrm {EAS} =a_{0}{\sqrt {{\frac {5P}{P_{0}}}\left[\left({\frac {q_{c}}{P}}+1\right)^{\frac {2}{7}}-1\right]}}}...
Click to read more »precursor may yield a mature RNA, although either the 3' (3p) or the 5' (5p) arm is preferentially processed and loaded into the RNA-induced silencing...
Click to read more »Deniz Öncü KTM Red Bull KTM Ajo 10F 24 6 9P 6 2P 1 3 11 1 11P 3 14 Ret 8 1F 5P F 11 3 5 223 5 Daniel Holgado KTM Red Bull KTM Tech3 1 4 5 6 1 1 3F 25 3 2...
Click to read more »Fernando Alonso 2 1 5 3 1PF 7F 2 7 2 1 4 3 1PF 3 Ret 2 3 109 4 Felipe Massa 6 5P 1PF 1PF 3 DSQ 3 2PF 5 2F 13 1P Ret 2F 6 3F 2P 94 5 Nick Heidfeld 4 4 4 Ret...
Click to read more »Geological Survey Professional Paper 264-D: 55–86. Bibcode:1954usgs.rept....5P. doi:10.3133/pp264D. Holmes, James D.; Paterson, John R.; García-Bellido,...
Click to read more »When You Were Mine (Media notes). Cyndi Lauper. Japan: Portrait. 1985. 07・5P-345.{{cite AV media notes}}: CS1 maint: others in cite AV media (notes) (link)...
Click to read more »objectively). Narrow face is seen in the following conditions and syndromes: 5p partial monosomy syndrome Bloom syndrome Branchiootorenal syndrome 1 Cardiofaciocutaneous...
Click to read more »FC. Retrieved 15 November 2021. "Wed 20 Aug 1980, Hearts 2 Hibernian 2 L 4-5p EoSS Final". London Hearts Supporters Club. Retrieved 15 November 2021. Bertie...
Click to read more »S/2001/963 United Nations Security Council "Range Resources: Speculative Buy at 25.5p – Target price 56p" (PDF). Range Resources. Archived from the original (PDF)...
Click to read more »free replacements are offered when the bag wears out. The UK has charged 5p per plastic carrier bag in larger shops since 2015. This trend has spread...
Click to read more »Japan 7" vinyl single (07•5P-443) No. Title Writer(s) Length 1. "Falling in Love (Uh-Oh)" (single remix) Lawrence Dermer Joe Galdo Rafael Vigil 3:07 2...
Click to read more »As this route is going to be electrified, an Asansol-based electric WAG-5P locomotive pulls the train to Samastipur Junction, and later a Samastipur-based...
Click to read more »단풍잎 Released in seven parts. 1990 The Third Golden Medal 세번째 금메달 1990 From 5p.m. to 5a.m. 5시부터 5시까지 Kim Yu Sam Jong Ui Kyom, Kim Chol Hyon, Hyon Chang Kol...
Click to read more »with the antimony center possessing two lone pairs of electrons and a vacant 5p orbital (Figure 1). Reflecting their unusual low coordination number (i.e...
Click to read more »most chromatic (colorful) purple in the sRGB gamut that falls in the hue of 5P (primary purple) in the Munsell color space. The color Byzantium is a dark...
Click to read more »Vizziello Yamaha 12 Ret 2 2 Ret 5 3 8 Ret 79 7 Ilario Dionisi Suzuki 4 2P Ret 9 5P 8 6 19 7 78 8 Enrique Rocamora Suzuki 2 5 Ret DNS 9 12 10 5 3 75 9 Bernat...
Click to read more »(H) UEFA Europa Conference League Play-off Ballkani 1–4 (A) 1−0 (H) 2026–27 UEFA Conference League 1Q Elbasani 1–1 (A) 0–0 (a.e.t),(4–5p) (H) 2Q Sion...
Click to read more »TRB-1004 TRB-1005 / TRB-1005F TRB-1006 TRB4 TRB5 TRB6 TRB4II TRB5II TRB6II TRB-5P TRB-6P TRB-5PII TRB-6PII TRB-6JP / TRB-6JP2 John Patitucci signature Magicstomp...
Click to read more »Squamous vs non-squamous cell miR-205 Small cell vs non-small cell miR-17-5p, miR-22, miR-24, miR-31 Gastric Diffuse vs intestinal miR-29b/c, miR-30 family...
Click to read more »draw in a two-game match against another Japanese professional, Inoue Kohei, 5p. In 1928, still only 14 years old, he twice defeated Hashimoto Utaro, 4p....
Click to read more »Iijima, Yoshitsugu (April 1997). "来 島大橋 主塔5Pの 架 設 時制振 対 策" [Vibration Control Of Kurushima Bridge Tower 5p Under Construction]. 土 木 学 会 論 文 集 (in Japanese)...
Click to read more »tissue preservation in Wales". Lethaia. 60 (1): 1–11. Bibcode:2026Letha..60..1.5P. doi:10.18261/let.60.1.5. Müller, T.; Vörös, A.; Haas, J.; Budai, T.; Ullmann...
Click to read more »Oil Prices Jump After Trump's Iran Speech Fails To Calm Jitters. Aired 4-5p ET". CNN. Retrieved April 11, 2026. Betts, Anna (June 18, 2026). "US House...
Click to read more »2010 May". The Minor Planet Bulletin. 38 (1): 5–7. Bibcode:2011MPBu...38....5P. ISSN 1052-8091. Retrieved 30 November 2017. Veres, Peter; Jedicke, Robert;...
Click to read more »Douglas WB-26 Invader (USAF) Grumman F9F-2P Panther (USN, USMC) Grumman F9F-5P Panther (USN, USMC) Lockheed RF-80C Shooting Star (USAF) McDonnell F2H-2P...
Click to read more »over het West-Brabantse geslacht Elsevier (A.M. Bosters. Voorburg, 2000, 5p) C.E.G. ten Houte de Lange, Stockmans, Stokmans, Elsevier Stokmans, Elzevier...
Click to read more »~17 kilograms (37 lb) Bay 4P APC/MISSE Carrier 57 kilograms (126 lb) Bay 5P APC/MISSE Carrier 57 kilograms (126 lb) Bay 7S ROEU umbilical ~79 kilograms...
Click to read more »Radunsky, Author, Vladimir Radunsky, Illustrator Candlewick Press (MA) $14.99 (5p) ISBN 978-0-7636-1532-1". "Discovery". Publishers Weekly. "What does peace...
Click to read more »at P. Benzophosphole Metallole Organophosphorus compound Phosphorine, C 5H 5P Nomenclature of Organic Chemistry: IUPAC Recommendations and Preferred Names...
Click to read more »AMP can be converted by two different pathways to hypoxanthine and ribose-5P, followed by irreversible oxidation of hypoxanthine to uric acid. This helps...
Click to read more »FD Total 18–22 April 2012 2012 World Team Trophy Senior 5 60.44 5 86.40 5T/5P 146.84 26–29 March 2012 2012 World Championships Senior 5 65.34 5 95.66 5...
Click to read more »navigation and stabilisation 1 × Fregat M2EM 3D circular scan radar 1 × Ratep JSC 5P-10E Puma fire-control system 1 × 3R14N-11356 fire-control system FCS 4 × MR-90...
Click to read more »SIN MAL JPN USA MEX BRA ABU Points 1 Lewis Hamilton 2P 1PF 2F 4 1PF 7 1PF 5P 4F 1PF 4 1P 1P 1F 2P 1P 1P 9 4 2 363 2 Sebastian Vettel 1 2 1 2P 2 1 4 4F...
Click to read more »Bertrigeoise (4) 21. Wingene (6) 2–0 Helkijn (6) 22. Wevelgem City (6) 0–0 (4–5p) De Ruiter Roeselare (6) 23. Damme (6) 4–0 Oostende (6) 24. Racing Waregem...
Click to read more »3 3 2 1 3F 5 4 1 3 4 7 6F 18 215 2 Callum Ilott 1F 9 5 5 8P 2 5 Ret 1P 6 5P 8 10 Ret 6P 1 12 6 3 7 2P 16 5 10 201 3 Yuki Tsunoda 18 11 2P F Ret 16 18...
Click to read more »satellite Sentinel-3A in 2016, and the air pollution-monitoring Sentinel-5p in 2017. The small-lift launch vehicle Vega, developed by the Italian company...
Click to read more »Team 1 Score Team 2 São Paulo 0–2 Santos Corinthians 1–1 (6–5p) Palmeiras...
Click to read more »Revista Mexicana de Astronomía y Astrofísica. 5: 5–7. Bibcode:1980RMxAA...5....5P. Retrieved 14 March 2023. Warman, J.; Pena, J. H.; Margrave, T. E. (October...
Click to read more »ETV1, and ZBTB18. The 3' UTR contains binding sites for the microRNAs miR-9-5p, miR-1294, miR-9986, miR-647, miR-628-3p, and miR-590-3p. The C21orf140 protein...
Click to read more »Ret 11 13 8 179 7 Celestino Vietti Kalex Red Bull KTM Ajo 9 7 10 9 Ret 7 10 5P 3 1P F 10 Ret 1F 12 7 DNS 1F Ret 165 8 Jake Dixon Kalex CFMoto Aspar Team...
Click to read more »storage Battery 5,000 mAh Li-Po Rear camera Primary: Sony IMX 386; 12 MP (5P lens), f/1.8, 28mm, 1/2.86", 1.25µm, PDAF Ultrawide: Hynix Hi-846; 8 MP, f/2...
Click to read more »London, Midland and Scottish Railway → British Railways Power class LMS: 5P Numbers L&YR: 1506-1525 (excl 1507/8, 1512/3, 1515), 1649–1683 LMS:10405–10474...
Click to read more »timing and scoring system allows them to have alphanumeric numbers (12P, 5P, for example, car numbers carry the first letter of the driver's surname)...
Click to read more »knots respectively. The aircraft was cleared for a Runway 14 takeoff and ZUE 5P departure. After a long takeoff run, the aircraft lifted off the runway at...
Click to read more »Team 1 Score Team 2 Noia 7–6 O'Parrulo Cidade de Narón 3–3 (3–5p) Mosteiro Bembrive L'Hospitalet Bellsport 4–5 Escola Pia Pallejà 2–1 La Unión San Juan...
Click to read more »Weekly; 8/22/2005, Vol. 252 Issue 33, p62-62, 1/5p Kirkus Reviews; 9/1/2005, Vol. 73 Issue 17, p971-971, 1/5p School Library Journal; Apr2006 Supplement,...
Click to read more »Retrieved June 18, 2022. "Sept. 14 Special Notice - Partial Loop Service 7A-5P". Detroit People Mover. September 14, 2022. Archived from the original on...
Click to read more »The five pence (5p) (Irish: cúig phingin) coin was a subdivision of the Irish pound. It was introduced in Ireland on Decimal Day, 15 February 1971 and...
Click to read more »incident over the Arequipa region. The FAP purchased the French-made Mirage 5P and 5DP and the Mirage 2000 in 1984. Relations improved with the United States...
Click to read more »they were well below expectations, and share prices fell to a low of 59.5p in June 2010. The company lost its chief financial officer, John Gittins,...
Click to read more »living in Effingham workhouse, were sold at Croydon market for one shilling (5p); the parish paid for the cost of the journey and a "wedding dinner". By the...
Click to read more »2026. All Elite Wrestling [@AEW] (May 5, 2026). "#AEWDoubleOrNothing 8e/5p, HBO Max PPV Sunday, 5/24! AEW World Tag Team Championship I Quit Match FTR...
Click to read more »(CIE RGB) × ≈ 260° ≈ Yellow/Lime Non-spectral violet ≈ 270° ≈ Lime Purple 5P (Munsell) for V = 3, C = 38 × ≈ 280° ≈ Chartreuse green Electric purple (sRGB)...
Click to read more »UV-VIS spectroscopy. Stannylenes can be viewed as sp2-hybridized with vacant 5p orbital and a lone pair. This gives rise to their red color from n to p transition...
Click to read more »SP FS Total 25–27 March 2022 2022 Channel One Trophy 4 89.43 6 137.32 1T/5P 226.75 23–27 February 2022 2022 Russian Cup Final 3 83.06 1 176.79 1 259.85...
Click to read more »manager to oversee the society lotteries. The ELM charges a management fee of 0.5p in every pound, which provides the profit for the lottery owners. The allocation...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »maint: deprecated archival service (link) Průša, Honza (2 August 2011). "5P: Stále jsme to my". Musicserver.cz (in Czech). Retrieved 30 June 2014. Hynek...
Click to read more »20 cigarettes was increased by 11p, while duty on petrol was raised by 7.5p per gallon. In his speech Lawson said that social security changes being brought...
Click to read more »It was the group's first recording session, for which they paid 17s 6d (87.5p or £17.82 in 2025). The recordings were pressed onto a mono 10-inch 78 rpm...
Click to read more »Ballymena United 1–0 Ards Portadown 1–0 Carrick Rangers 20 January 2010 Ballymoney United 0–1 Institute 27 January 2010 Bryansburn Rangers 2–2 (3–5p) Nortel...
Click to read more »injection of ash and sulfur dioxide. A study with the ESA satellite Sentinel-5P revealed volcano's sulphur dioxide plume had clustered into distinct structures...
Click to read more »Transaero[citation needed] 747-85M 5N Shandong Airlines 737-35N 737-75N 737-85N 5P Air Europa 737-85P 5R Jet Airways 737-45R 737-75R 737-85R 737-95R 777-35RER...
Click to read more »17', Lafferty 70' 1,022 13 July 2022 Group stage Partick Thistle H 1–1 (4–5p) Donnelly 11' 3,012 16 July 2022 Group stage Montrose A 3–0 McInroy 37', Armstrong...
Click to read more »Security benefits. Excise duty on beer was increased by 1p. There was also a 5p duty increase on a bottle of wine, a 25p increase on a litre of spirits, and...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Arieşul Turda were deducted 8 points for unpaid debts. 1.Arieşul 7P.; 2.Avântul 5P.; 3.Industria 4P. SĂN 1-0 GLO; GLO 1–1 SĂN Gloria Bistriţa were deducted 12...
Click to read more »brownfield sites, development of active travel routes and the introduction of a 5p plastic bag charge. Shimmins indicated that he does not support independence...
Click to read more »edu/people/minkara-mona/ https://www.minkaracombinelab.com/ https://www.youtube.com/watch?v=5pJMQaolzGg https://www.minkaracombinelab.com/Research https://coe.northeastern...
Click to read more »Martin HC, Wani S, Nones K, Waddell N, et al. (February 2013). "MicroRNA-182-5p targets a network of genes involved in DNA repair". RNA. 19 (2): 230–42. doi:10...
Click to read more »Blackburn Cirrus Major engine, first flown in 1951. This was followed by the J/5P Autocar, powered by a Gipsy Major 10 engine. The need for rugged inexpensive...
Click to read more »as the greatest whales". Lethaia. 56 (2): 1–11. Bibcode:2023Letha..56..2.5P. doi:10.18261/let.56.2.5. ISSN 0024-1164. S2CID 259782734. Yadagiri, P. and...
Click to read more »Magik Muzik CD, Single Magik Muzik 801-1 2001 vinyl, 12", Promo BHMM 801-5P June 22, 2001 CD, Maxi Magik Muzik 801-2 2001 2 x vinyl, 12" Magik Muzik 801-5...
Click to read more »Cui J, et al. (October 2011). "Combination of hsa-miR-375 and hsa-miR-142-5p as a predictor for recurrence risk in gastric cancer patients following surgical...
Click to read more »orbitals in oxygen, though there are slight contributions from silver's 5s and 5p orbitals. Silver(III) oxide/zeolite has proposed as a catalyst for oxidative...
Click to read more »Wang, Siliang; Wu, Simeng; Yuan, Zhe; Zhu, Xike (January 2021). "miRNA-146a-5p mitigates stress-induced premature senescence of D-galactose-induced primary...
Click to read more »2008-04-05. Saturday Evening Post, March 20, 1943, Vol. 215 Issue 38, p. 4-4, 1/5p; (AN 18990616). "Getting Hitler's Goat is Montana Pastime". Sarasota Herald...
Click to read more »rearrangements Contiguous gene deletion 4p deletion (Wolf–Hirschhorn syndrome) 5p deletion (Cri-du-chat) 7q11.23 deletion (Williams syndrome) 22q11 deletion...
Click to read more »MiG-17PF 70 30 units were Czechoslovak-built S-104 and 40 were Polish-built Lim-5P MiG-19 Soviet Union Fighter MiG-19S 35 MiG-21 Soviet Union Fighter MiG-21F-13...
Click to read more »significant milestone. Excise duty was increased on alcohol and cigarettes, with 1.5p on a pint of beer, 6p on a bottle of wine, 10p on a litre of spirits, 6p on...
Click to read more »1968–2003 6p Known for spreading Go around the world. Catalin Taranu 1973– 5p One of Romania's best players and a pro in Japan. Affiliate of the Nihon Ki-In...
Click to read more »17 2 6 7 17 3 19 1 7 13 15 11 15F 9 DSQ 20† 14 17 12 Gabriel Bortoleto 6 5P 10 Ret Ret Ret 6 2P 2 8 5 10 4 1 4 6 16F 4 10 2 8 1 5 4F 5 3 2 2 2025 ALB...
Click to read more »Surface-to-air missile warheads (5B18, the warhead for the S-125's V-601 missile) 5P: Surface-to-air missile launchers (5P75, the four-missile launcher for the...
Click to read more »v t e Sterling coinage Decimal system 1/2p 1p 2p 5p 10p 20p 50p £1 £2 £sd system Quarter farthing (1/16d.) (Ceylon) Third farthing (1/12d.) (Malta)...
Click to read more »Society with branches nationwide. By paying a suggested seven old pence (2.5p) per week, members could ensure sickness benefit of at least five shillings...
Click to read more »learning fun". Publishers Weekly; 11/21/2005, Vol. 252 Issue 46, p46-46, 1/5p, 1 color Kirkus Reviews; 1/1/2006, Vol. 74 Issue 1, p38-38, 1/6p School Library...
Click to read more »goals scored. (C) Champions; (P) Promoted; (R) Relegated Notes: AEZ 7p; ENAD 5p; Adonis 4p Ethnikos 12p; PAEEK 6p; Elpida 0p Source: [citation needed] Legend:...
Click to read more »manufacturer's profit is given by ( w − 2 ) ( 5 − 0.5 p m ) {\displaystyle (w-2)(5-0.5p_{m})} . Thus, its profit maximizing price is w = 6 {\displaystyle w=6} , leading...
Click to read more »for the cost of capital, much higher than the expected cost in 1995 of 3.5p/kWh (2000 prices, equivalent to £67/MWh in 2025). Sizewell B was built and...
Click to read more »Rank Player Club(s) Country 1P 2P 3P 4P 5P Points 1 Rivaldo Barcelona Brazil 63 40 14 7 5 543 2 David Beckham Manchester United England 31 16 21 11 9 194...
Click to read more »Rattican Elite Motorsports with Entire Race Engineering 4 21 6 Ret 8P 2P 5P 7 1 Ret 12P 2P 106 6 Erik Evans Marco Signoretti Academy Motorsport 1 8 1...
Click to read more »immunodeficiency Ischiopatellar dysplasia Isochromosome 18p syndrome Isochromosome i (5p) Isochromosome 18p syndrome Isosporosiasis Isotretinoin embryopathy Isthmian...
Click to read more »Stuttgart 1–1 2–2 Trabzonspor 1–3 Dnipro Dnipropetrovsk 1–0 0–3 Aberdeen 3–3 (4–5p) BFC Dynamo 2–1 1–2 Austria Wien 8–0 Valletta 4–0 4–0 Lech Poznań 0–5 Liverpool...
Click to read more »under Ben Tillett and John Burns. This led to a demand for 6d per hour (2.5p), and an end to casual labour in the docks. After a bitter struggle, the London...
Click to read more »(link) Clean, Clean, Bruce Woolley and the Camera Club, Epic Records, 1979, 06・5P-88{{citation}}: CS1 maint: others (link) Dancing With The Sporting Boys, Bruce...
Click to read more »the New York Academy of Sciences. 1464 (1): 5–29. Bibcode:2020NYASA1464....5P. doi:10.1111/nyas.13948. ISSN 1749-6632. PMC 6367070. PMID 30085354. Cutini...
Click to read more »46 Dra c 46 173524 91755 18h 42m 37.96s +55° 32′ 21.8″ 5.03 −0.21 364 B9.5p... 17 Dra 17 150117 81292 16h 36m 13.73s +52° 55′ 27.7″ 5.07 −0.36 397 B9V...
Click to read more »Corel Photo-Paint SELECT with HP scanning hardware, e.g., the HP ScanJet 5p scanners. Photo-Paint's native format is .CPT (Corel Photo-Paint Image), which...
Click to read more »5G Greenland Sea 5K- 5K Kara Sea 5L- 5L Lincoln Sea 5N- 5N Norwegian Sea 5P- 5P Laptev Sea 5R- 5R Bering Strait 5S- 5S East Siberian Sea 5T- 5T Northwest...
Click to read more »1–2 (A) Matchday 2 West Ham United U21 0–2 (H) FC Halifax Town 2–2 (A) (3–5p.) Matchday 3 West Bromwich Albion U21 2–2 (H) (3–1p.) Tamworth 2–1 (A) Matchday...
Click to read more »Latvian goddess MARA (anti-tank weapon), Argentine antitank missile Mirage 5P Mara, upgraded Dassault Mirage 5 aircraft for the Argentine Air Force Shell...
Click to read more »Lokomotiv Moscow 0–1 5–0 Brøndby 3–0 Lillestrøm 3–0 0–0 Chornomorets Odesa 1–1 (6-5p) Widzew Łódź 1–0 0–1 Spartak Vladikavkaz 1–2 Liverpool 1–2 0–0 Fenerbahçe...
Click to read more »Season Played W D L Goals +/- Points 1928–29 4 2 1 1 10:9 +1 5p...
Click to read more »Pos. Played W D L GS GA Points Notes Ref 1912–13 Divizia A 3 6 2 1 3 13 16 5p First Edition in Romanian First League 1913–14 Divizia A 2 2 – 1 1 1 3 1p...
Click to read more »(flagship model) (1991) Z-20 (1992) Z-50 (1992) Z-1P (flagship model) (1994) Z-5P (1994) Z-70 (1995) This innovative series brought the "small and light" concept...
Click to read more »as the greatest whales". Lethaia. 56 (2): 1–11. Bibcode:2023Letha..56..2.5P. doi:10.18261/let.56.2.5. S2CID 259782734. Lacovara, K.J.; Ibiricu, L.M.;...
Click to read more »